Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641672_at:

>probe:Drosophila_2:1641672_at:102:83; Interrogation_Position=27124; Antisense; AGTGCTCTACTTCCGGTTGCAACGG
>probe:Drosophila_2:1641672_at:539:359; Interrogation_Position=27142; Antisense; GCAACGGCCGTAGTCGATAAGCTAA
>probe:Drosophila_2:1641672_at:686:615; Interrogation_Position=27208; Antisense; TCGGATGTTGCTGCCGTAAACCCCT
>probe:Drosophila_2:1641672_at:387:491; Interrogation_Position=27223; Antisense; GTAAACCCCTATGTTGCACGTGCAA
>probe:Drosophila_2:1641672_at:722:351; Interrogation_Position=27289; Antisense; GCAGCAGAAATACCTCCGGCAGCAA
>probe:Drosophila_2:1641672_at:349:435; Interrogation_Position=27352; Antisense; GAGGTGGTGGCATTGCCCACCGAAA
>probe:Drosophila_2:1641672_at:101:391; Interrogation_Position=27439; Antisense; GAAACGCCATCGACAACTAGCAACA
>probe:Drosophila_2:1641672_at:606:375; Interrogation_Position=27516; Antisense; GAAGCTTTTCTGTGTGGTTTCGGTA
>probe:Drosophila_2:1641672_at:315:539; Interrogation_Position=27531; Antisense; GGTTTCGGTATTTGTTCATGGCTTT
>probe:Drosophila_2:1641672_at:19:647; Interrogation_Position=27546; Antisense; TCATGGCTTTTATACGGCAATCGAT
>probe:Drosophila_2:1641672_at:331:289; Interrogation_Position=27560; Antisense; CGGCAATCGATCGTGTTGCTGTTGT
>probe:Drosophila_2:1641672_at:469:729; Interrogation_Position=27581; Antisense; TTGTGGCCAGGTTCCGACCAACGGA
>probe:Drosophila_2:1641672_at:365:335; Interrogation_Position=27607; Antisense; GCTGCTGCGGCAACACATTGCAACA
>probe:Drosophila_2:1641672_at:223:245; Interrogation_Position=27654; Antisense; AATTGCCCGCCGTGAAGTTGGTCCG

Paste this into a BLAST search page for me
AGTGCTCTACTTCCGGTTGCAACGGGCAACGGCCGTAGTCGATAAGCTAATCGGATGTTGCTGCCGTAAACCCCTGTAAACCCCTATGTTGCACGTGCAAGCAGCAGAAATACCTCCGGCAGCAAGAGGTGGTGGCATTGCCCACCGAAAGAAACGCCATCGACAACTAGCAACAGAAGCTTTTCTGTGTGGTTTCGGTAGGTTTCGGTATTTGTTCATGGCTTTTCATGGCTTTTATACGGCAATCGATCGGCAATCGATCGTGTTGCTGTTGTTTGTGGCCAGGTTCCGACCAACGGAGCTGCTGCGGCAACACATTGCAACAAATTGCCCGCCGTGAAGTTGGTCCG

Full Affymetrix probeset data:

Annotations for 1641672_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime