FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641673_at:

>probe:Drosophila_2:1641673_at:122:611; Interrogation_Position=1981; Antisense; TGACGACTATCCGTGCGAGCAGATT
>probe:Drosophila_2:1641673_at:391:15; Interrogation_Position=2003; Antisense; ATTAGCTCCGCGGAGGAGTGCCTAA
>probe:Drosophila_2:1641673_at:617:431; Interrogation_Position=2018; Antisense; GAGTGCCTAAAGATGGCCCTGCATA
>probe:Drosophila_2:1641673_at:240:577; Interrogation_Position=2032; Antisense; GGCCCTGCATATCATGGCGGACGCA
>probe:Drosophila_2:1641673_at:8:435; Interrogation_Position=2074; Antisense; GATGTAATCGGATCCTGCCGCTGAA
>probe:Drosophila_2:1641673_at:192:307; Interrogation_Position=2131; Antisense; CCTTTGCTAACTTTAACTGGAGACA
>probe:Drosophila_2:1641673_at:227:263; Interrogation_Position=2154; Antisense; CAGCGTATTACAAGCGAGACACAAA
>probe:Drosophila_2:1641673_at:519:27; Interrogation_Position=2202; Antisense; ATACATGTTGTTGCCATAAGTCTGT
>probe:Drosophila_2:1641673_at:57:273; Interrogation_Position=2216; Antisense; CATAAGTCTGTAGCGCAGGCAGCAG
>probe:Drosophila_2:1641673_at:607:527; Interrogation_Position=2252; Antisense; GGGAGCATGCCCTTAACTTTTATAT
>probe:Drosophila_2:1641673_at:661:493; Interrogation_Position=2279; Antisense; GTAATTGTACATTTTCGACCTTTGA
>probe:Drosophila_2:1641673_at:86:691; Interrogation_Position=2299; Antisense; TTTGATTATGTTTTACCCCGCACCA
>probe:Drosophila_2:1641673_at:158:453; Interrogation_Position=2458; Antisense; GATCACAACAATGTCTTCGATGAAA
>probe:Drosophila_2:1641673_at:420:543; Interrogation_Position=2496; Antisense; GGATTATTATGCAACCTACGTCGTT

Paste this into a BLAST search page for me
TGACGACTATCCGTGCGAGCAGATTATTAGCTCCGCGGAGGAGTGCCTAAGAGTGCCTAAAGATGGCCCTGCATAGGCCCTGCATATCATGGCGGACGCAGATGTAATCGGATCCTGCCGCTGAACCTTTGCTAACTTTAACTGGAGACACAGCGTATTACAAGCGAGACACAAAATACATGTTGTTGCCATAAGTCTGTCATAAGTCTGTAGCGCAGGCAGCAGGGGAGCATGCCCTTAACTTTTATATGTAATTGTACATTTTCGACCTTTGATTTGATTATGTTTTACCCCGCACCAGATCACAACAATGTCTTCGATGAAAGGATTATTATGCAACCTACGTCGTT

Full Affymetrix probeset data:

Annotations for 1641673_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720