FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641675_at:

>probe:Drosophila_2:1641675_at:173:117; Interrogation_Position=2206; Antisense; AGCTTCTACTTCTGAGGTGGTGGTT
>probe:Drosophila_2:1641675_at:417:727; Interrogation_Position=2229; Antisense; TTGGCCACCAAGCAATATCGCCGGA
>probe:Drosophila_2:1641675_at:47:257; Interrogation_Position=2271; Antisense; CACAAACTTTACATATCGCCCGATT
>probe:Drosophila_2:1641675_at:49:635; Interrogation_Position=2286; Antisense; TCGCCCGATTGCTGGAAGGCTGTCA
>probe:Drosophila_2:1641675_at:544:459; Interrogation_Position=2317; Antisense; GATATTCAGCTTCCAAATGCTTGGC
>probe:Drosophila_2:1641675_at:334:65; Interrogation_Position=2366; Antisense; ATGGAGAACTACATGGCCCGGGAAA
>probe:Drosophila_2:1641675_at:632:537; Interrogation_Position=2416; Antisense; GGTCAGCCAACCCAGAAATTCAAGT
>probe:Drosophila_2:1641675_at:544:377; Interrogation_Position=2450; Antisense; GACAGTATTTTAGCCAATTGCCGAT
>probe:Drosophila_2:1641675_at:36:721; Interrogation_Position=2467; Antisense; TTGCCGATATGCCATTATAGCCCCA
>probe:Drosophila_2:1641675_at:444:189; Interrogation_Position=2504; Antisense; AACATGGCATTTCCGCAACCAGAGA
>probe:Drosophila_2:1641675_at:150:419; Interrogation_Position=2547; Antisense; GAGCTGCAGCACAATCTCCTGGAAG
>probe:Drosophila_2:1641675_at:288:403; Interrogation_Position=2605; Antisense; GACTTCTGCATCGATCTGTGTAAAT
>probe:Drosophila_2:1641675_at:221:549; Interrogation_Position=2658; Antisense; GGAGGCCGACCGAAATGCAAATCAA
>probe:Drosophila_2:1641675_at:307:487; Interrogation_Position=2745; Antisense; GTAGCCCCTAGTAATTCTATTTTTG

Paste this into a BLAST search page for me
AGCTTCTACTTCTGAGGTGGTGGTTTTGGCCACCAAGCAATATCGCCGGACACAAACTTTACATATCGCCCGATTTCGCCCGATTGCTGGAAGGCTGTCAGATATTCAGCTTCCAAATGCTTGGCATGGAGAACTACATGGCCCGGGAAAGGTCAGCCAACCCAGAAATTCAAGTGACAGTATTTTAGCCAATTGCCGATTTGCCGATATGCCATTATAGCCCCAAACATGGCATTTCCGCAACCAGAGAGAGCTGCAGCACAATCTCCTGGAAGGACTTCTGCATCGATCTGTGTAAATGGAGGCCGACCGAAATGCAAATCAAGTAGCCCCTAGTAATTCTATTTTTG

Full Affymetrix probeset data:

Annotations for 1641675_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720