Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641676_at:

>probe:Drosophila_2:1641676_at:414:183; Interrogation_Position=1551; Antisense; AAAAGCCCAGTGAGAGAGCCGTCAT
>probe:Drosophila_2:1641676_at:453:101; Interrogation_Position=1565; Antisense; AGAGCCGTCATTTGAGAGGTCGCCG
>probe:Drosophila_2:1641676_at:629:623; Interrogation_Position=1606; Antisense; TGCGCCGCACCAGAGCAGATGAAGC
>probe:Drosophila_2:1641676_at:479:351; Interrogation_Position=1620; Antisense; GCAGATGAAGCCCAGCCAGGCGAAA
>probe:Drosophila_2:1641676_at:519:313; Interrogation_Position=1634; Antisense; GCCAGGCGAAAGTGGAGCACCCAAT
>probe:Drosophila_2:1641676_at:640:299; Interrogation_Position=1691; Antisense; CCCTGCGGATGCTGCGAATGCAATA
>probe:Drosophila_2:1641676_at:260:597; Interrogation_Position=1780; Antisense; TGTACGAATGCGGTTCTTAGCGATT
>probe:Drosophila_2:1641676_at:231:657; Interrogation_Position=1807; Antisense; TAATGCTGCTTTATTGTACGCGATT
>probe:Drosophila_2:1641676_at:360:601; Interrogation_Position=1821; Antisense; TGTACGCGATTGACTCCACGGGAGA
>probe:Drosophila_2:1641676_at:154:153; Interrogation_Position=1868; Antisense; ACAGAGCGACACTTACGGACACATA
>probe:Drosophila_2:1641676_at:100:559; Interrogation_Position=1884; Antisense; GGACACATACCGCTTTTTGATGATC
>probe:Drosophila_2:1641676_at:315:427; Interrogation_Position=1951; Antisense; GAGATCGAGGCAATCGCCTTAGCCC
>probe:Drosophila_2:1641676_at:559:313; Interrogation_Position=1966; Antisense; GCCTTAGCCCGGTGTGTATTTATAT
>probe:Drosophila_2:1641676_at:724:691; Interrogation_Position=2012; Antisense; TTTCCTTTCGTATATTCGTCTGTAT

Paste this into a BLAST search page for me
AAAAGCCCAGTGAGAGAGCCGTCATAGAGCCGTCATTTGAGAGGTCGCCGTGCGCCGCACCAGAGCAGATGAAGCGCAGATGAAGCCCAGCCAGGCGAAAGCCAGGCGAAAGTGGAGCACCCAATCCCTGCGGATGCTGCGAATGCAATATGTACGAATGCGGTTCTTAGCGATTTAATGCTGCTTTATTGTACGCGATTTGTACGCGATTGACTCCACGGGAGAACAGAGCGACACTTACGGACACATAGGACACATACCGCTTTTTGATGATCGAGATCGAGGCAATCGCCTTAGCCCGCCTTAGCCCGGTGTGTATTTATATTTTCCTTTCGTATATTCGTCTGTAT

Full Affymetrix probeset data:

Annotations for 1641676_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime