Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641677_at:

>probe:Drosophila_2:1641677_at:143:601; Interrogation_Position=2198; Antisense; TGTACATTTACTCTGTCCCCATTTC
>probe:Drosophila_2:1641677_at:515:503; Interrogation_Position=2212; Antisense; GTCCCCATTTCTTGTTATCACTGTA
>probe:Drosophila_2:1641677_at:712:405; Interrogation_Position=2271; Antisense; GACTGTAACATATATATTTCGCACG
>probe:Drosophila_2:1641677_at:480:17; Interrogation_Position=2286; Antisense; ATTTCGCACGTTTTTATACATAATC
>probe:Drosophila_2:1641677_at:86:61; Interrogation_Position=2447; Antisense; ATGTGTACAGTTCTCGACGGTGTGC
>probe:Drosophila_2:1641677_at:588:505; Interrogation_Position=2468; Antisense; GTGCGGCTTCGCTCTATGCTTGATG
>probe:Drosophila_2:1641677_at:481:123; Interrogation_Position=2513; Antisense; AGCCCTGCTTGACACACAACATTAG
>probe:Drosophila_2:1641677_at:124:705; Interrogation_Position=2534; Antisense; TTAGCAAATCTCTAGTTCGTAAGTC
>probe:Drosophila_2:1641677_at:146:241; Interrogation_Position=2563; Antisense; AATCAAGCATCGCTTTACCTGCACA
>probe:Drosophila_2:1641677_at:650:671; Interrogation_Position=2578; Antisense; TACCTGCACAATCCCCAGAGGAAAG
>probe:Drosophila_2:1641677_at:211:203; Interrogation_Position=2600; Antisense; AAGCCTCCCGAAATCAACCAACTTG
>probe:Drosophila_2:1641677_at:371:187; Interrogation_Position=2615; Antisense; AACCAACTTGTAGCGAATTCCACGG
>probe:Drosophila_2:1641677_at:480:245; Interrogation_Position=2630; Antisense; AATTCCACGGGTTCGCTTCCGAGAG
>probe:Drosophila_2:1641677_at:301:481; Interrogation_Position=2681; Antisense; GTAAGGCAAACGCAATGTTCTCATT

Paste this into a BLAST search page for me
TGTACATTTACTCTGTCCCCATTTCGTCCCCATTTCTTGTTATCACTGTAGACTGTAACATATATATTTCGCACGATTTCGCACGTTTTTATACATAATCATGTGTACAGTTCTCGACGGTGTGCGTGCGGCTTCGCTCTATGCTTGATGAGCCCTGCTTGACACACAACATTAGTTAGCAAATCTCTAGTTCGTAAGTCAATCAAGCATCGCTTTACCTGCACATACCTGCACAATCCCCAGAGGAAAGAAGCCTCCCGAAATCAACCAACTTGAACCAACTTGTAGCGAATTCCACGGAATTCCACGGGTTCGCTTCCGAGAGGTAAGGCAAACGCAATGTTCTCATT

Full Affymetrix probeset data:

Annotations for 1641677_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime