Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641683_at:

>probe:Drosophila_2:1641683_at:11:103; Interrogation_Position=1089; Antisense; AGAGCTTCGTCGCTGGGACCAAGAA
>probe:Drosophila_2:1641683_at:720:553; Interrogation_Position=1104; Antisense; GGACCAAGAATAACCTGTGCCGCGT
>probe:Drosophila_2:1641683_at:495:545; Interrogation_Position=1145; Antisense; GGATCGCCGCTGTGGTACGACGAAC
>probe:Drosophila_2:1641683_at:256:157; Interrogation_Position=1168; Antisense; ACACTTCGGCGAGGATCTGATCAAG
>probe:Drosophila_2:1641683_at:156:285; Interrogation_Position=1184; Antisense; CTGATCAAGTTTCTCACACTGCTGA
>probe:Drosophila_2:1641683_at:604:561; Interrogation_Position=1221; Antisense; GGAACTGCAACTCCGTGTGCCTGAT
>probe:Drosophila_2:1641683_at:141:465; Interrogation_Position=1264; Antisense; GATTGCCAAGTACGATGCCAGCCTA
>probe:Drosophila_2:1641683_at:440:97; Interrogation_Position=1296; Antisense; AGATCCGCCAACTGGTGGACTATGC
>probe:Drosophila_2:1641683_at:105:43; Interrogation_Position=1322; Antisense; ATCGAACTGGAGTCGTTTGCCGGTT
>probe:Drosophila_2:1641683_at:203:717; Interrogation_Position=1338; Antisense; TTGCCGGTTCGGAGCGTGAAACGCA
>probe:Drosophila_2:1641683_at:570:581; Interrogation_Position=1384; Antisense; TGGCCTGCTCCATTTGCACAAGATG
>probe:Drosophila_2:1641683_at:153:551; Interrogation_Position=1519; Antisense; GGAGTCATCTGCCAAGCCGGACAAT
>probe:Drosophila_2:1641683_at:147:559; Interrogation_Position=1537; Antisense; GGACAATTGCATCTCTGGTCTACTG
>probe:Drosophila_2:1641683_at:516:123; Interrogation_Position=1579; Antisense; AGCCTCGCTGGATTTCTAGCTGTCA

Paste this into a BLAST search page for me
AGAGCTTCGTCGCTGGGACCAAGAAGGACCAAGAATAACCTGTGCCGCGTGGATCGCCGCTGTGGTACGACGAACACACTTCGGCGAGGATCTGATCAAGCTGATCAAGTTTCTCACACTGCTGAGGAACTGCAACTCCGTGTGCCTGATGATTGCCAAGTACGATGCCAGCCTAAGATCCGCCAACTGGTGGACTATGCATCGAACTGGAGTCGTTTGCCGGTTTTGCCGGTTCGGAGCGTGAAACGCATGGCCTGCTCCATTTGCACAAGATGGGAGTCATCTGCCAAGCCGGACAATGGACAATTGCATCTCTGGTCTACTGAGCCTCGCTGGATTTCTAGCTGTCA

Full Affymetrix probeset data:

Annotations for 1641683_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime