Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641684_at:

>probe:Drosophila_2:1641684_at:591:121; Interrogation_Position=114; Antisense; AGCGAAGGCTTCTGTGGGAATCTCT
>probe:Drosophila_2:1641684_at:207:527; Interrogation_Position=129; Antisense; GGGAATCTCTTCGATGTCAATCAAG
>probe:Drosophila_2:1641684_at:499:33; Interrogation_Position=148; Antisense; ATCAAGCATCCGCAGCTGATCATGA
>probe:Drosophila_2:1641684_at:693:551; Interrogation_Position=15; Antisense; GGAGCTCTCGTTGGATGAACCGCAA
>probe:Drosophila_2:1641684_at:229:371; Interrogation_Position=171; Antisense; GAAGGCGATTGTTCCAGTGGTTATG
>probe:Drosophila_2:1641684_at:386:589; Interrogation_Position=243; Antisense; TGGATCACTTAGCAGCCCCTATAGC
>probe:Drosophila_2:1641684_at:68:683; Interrogation_Position=262; Antisense; TATAGCGCCTACAAGGGTTTCCTAA
>probe:Drosophila_2:1641684_at:199:539; Interrogation_Position=277; Antisense; GGTTTCCTAAACCTCAGTGCTGGAC
>probe:Drosophila_2:1641684_at:381:325; Interrogation_Position=353; Antisense; GCGAAGCTGGAGTCCGTGCATCTGC
>probe:Drosophila_2:1641684_at:393:625; Interrogation_Position=375; Antisense; TGCCCAGCAGCCAAAACTCTTTGTG
>probe:Drosophila_2:1641684_at:530:687; Interrogation_Position=419; Antisense; TATTTGCCGAGGTCTTGGGTCTGTA
>probe:Drosophila_2:1641684_at:583:535; Interrogation_Position=436; Antisense; GGTCTGTATGGTCTCATAGTGGCCA
>probe:Drosophila_2:1641684_at:308:507; Interrogation_Position=72; Antisense; GTGCGCCATTGTCTTTTCGACATTG
>probe:Drosophila_2:1641684_at:662:633; Interrogation_Position=88; Antisense; TCGACATTGGGAGCCGCCTACGGAA

Paste this into a BLAST search page for me
AGCGAAGGCTTCTGTGGGAATCTCTGGGAATCTCTTCGATGTCAATCAAGATCAAGCATCCGCAGCTGATCATGAGGAGCTCTCGTTGGATGAACCGCAAGAAGGCGATTGTTCCAGTGGTTATGTGGATCACTTAGCAGCCCCTATAGCTATAGCGCCTACAAGGGTTTCCTAAGGTTTCCTAAACCTCAGTGCTGGACGCGAAGCTGGAGTCCGTGCATCTGCTGCCCAGCAGCCAAAACTCTTTGTGTATTTGCCGAGGTCTTGGGTCTGTAGGTCTGTATGGTCTCATAGTGGCCAGTGCGCCATTGTCTTTTCGACATTGTCGACATTGGGAGCCGCCTACGGAA

Full Affymetrix probeset data:

Annotations for 1641684_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime