Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641685_at:

>probe:Drosophila_2:1641685_at:661:109; Interrogation_Position=3492; Antisense; AGAAGGTTGCGACTCAGCAAGGCAA
>probe:Drosophila_2:1641685_at:677:465; Interrogation_Position=3577; Antisense; GTTGTAAACTCCAATCATGTTGATG
>probe:Drosophila_2:1641685_at:523:357; Interrogation_Position=3609; Antisense; GCAAATTCAATTTCCAAACCCATCA
>probe:Drosophila_2:1641685_at:489:231; Interrogation_Position=3658; Antisense; AATGCGGATCAATCAGCCGCCAGGC
>probe:Drosophila_2:1641685_at:521:69; Interrogation_Position=3679; Antisense; AGGCGGATCCCGCAGTGACTGTTTT
>probe:Drosophila_2:1641685_at:250:265; Interrogation_Position=3691; Antisense; CAGTGACTGTTTTGCGTTAGGAGTA
>probe:Drosophila_2:1641685_at:640:427; Interrogation_Position=3711; Antisense; GAGTAGAAACGATGACCAGACCTTA
>probe:Drosophila_2:1641685_at:477:421; Interrogation_Position=3762; Antisense; GAGAAGGTTTTTCCAATACCACAGT
>probe:Drosophila_2:1641685_at:165:493; Interrogation_Position=3785; Antisense; GTAACCACAGATTTCACAGCCAAAC
>probe:Drosophila_2:1641685_at:453:179; Interrogation_Position=3876; Antisense; AAAACATCTATTTTTGGGCCAATTG
>probe:Drosophila_2:1641685_at:210:697; Interrogation_Position=3973; Antisense; TTTTTGGAACCAGAAATCGGGCAGA
>probe:Drosophila_2:1641685_at:329:393; Interrogation_Position=4015; Antisense; GAAAGTCCTTTCCAACGTAACAGCA
>probe:Drosophila_2:1641685_at:237:29; Interrogation_Position=4050; Antisense; ATACAAAACAACACCGAGAAGCCTT
>probe:Drosophila_2:1641685_at:323:295; Interrogation_Position=4064; Antisense; CGAGAAGCCTTCTCATGGAAGAAAA

Paste this into a BLAST search page for me
AGAAGGTTGCGACTCAGCAAGGCAAGTTGTAAACTCCAATCATGTTGATGGCAAATTCAATTTCCAAACCCATCAAATGCGGATCAATCAGCCGCCAGGCAGGCGGATCCCGCAGTGACTGTTTTCAGTGACTGTTTTGCGTTAGGAGTAGAGTAGAAACGATGACCAGACCTTAGAGAAGGTTTTTCCAATACCACAGTGTAACCACAGATTTCACAGCCAAACAAAACATCTATTTTTGGGCCAATTGTTTTTGGAACCAGAAATCGGGCAGAGAAAGTCCTTTCCAACGTAACAGCAATACAAAACAACACCGAGAAGCCTTCGAGAAGCCTTCTCATGGAAGAAAA

Full Affymetrix probeset data:

Annotations for 1641685_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime