FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641686_at:

>probe:Drosophila_2:1641686_at:140:465; Interrogation_Position=1129; Antisense; GATTGCCTGCAATGCGAGCTCAGTT
>probe:Drosophila_2:1641686_at:277:337; Interrogation_Position=1146; Antisense; GCTCAGTTGCTCGAAAACCGTTTTC
>probe:Drosophila_2:1641686_at:646:679; Interrogation_Position=1214; Antisense; TAGGTGTGCTGGTCGAGTTTCTCAC
>probe:Drosophila_2:1641686_at:565:261; Interrogation_Position=1236; Antisense; CACCTGGCCGATTATTCGCTATAAG
>probe:Drosophila_2:1641686_at:442:685; Interrogation_Position=1255; Antisense; TATAAGCGTGAGGTCCTTTTCGGCT
>probe:Drosophila_2:1641686_at:60:543; Interrogation_Position=1281; Antisense; GGTTGATCTGTTGGTGTCCTTTGGC
>probe:Drosophila_2:1641686_at:410:363; Interrogation_Position=1307; Antisense; GAATTGCCAGCCTTTTTCTTGGATT
>probe:Drosophila_2:1641686_at:572:697; Interrogation_Position=1321; Antisense; TTTCTTGGATTTTCACTGCTTTCGG
>probe:Drosophila_2:1641686_at:600:687; Interrogation_Position=1360; Antisense; TATTATTTTACGCTGCGAGCCTGCT
>probe:Drosophila_2:1641686_at:205:327; Interrogation_Position=1374; Antisense; GCGAGCCTGCTGCATGGTCTATAAA
>probe:Drosophila_2:1641686_at:627:221; Interrogation_Position=1491; Antisense; AAGGATCGGAGACACGCCCACTTCG
>probe:Drosophila_2:1641686_at:29:73; Interrogation_Position=1592; Antisense; AGGACTACTCCCTCAACACAAAGAA
>probe:Drosophila_2:1641686_at:195:1; Interrogation_Position=1627; Antisense; ACACCCAAAGTTGTACCCGACTATG
>probe:Drosophila_2:1641686_at:325:59; Interrogation_Position=1688; Antisense; ATGATCATTCTCAGTACATGCCCTG

Paste this into a BLAST search page for me
GATTGCCTGCAATGCGAGCTCAGTTGCTCAGTTGCTCGAAAACCGTTTTCTAGGTGTGCTGGTCGAGTTTCTCACCACCTGGCCGATTATTCGCTATAAGTATAAGCGTGAGGTCCTTTTCGGCTGGTTGATCTGTTGGTGTCCTTTGGCGAATTGCCAGCCTTTTTCTTGGATTTTTCTTGGATTTTCACTGCTTTCGGTATTATTTTACGCTGCGAGCCTGCTGCGAGCCTGCTGCATGGTCTATAAAAAGGATCGGAGACACGCCCACTTCGAGGACTACTCCCTCAACACAAAGAAACACCCAAAGTTGTACCCGACTATGATGATCATTCTCAGTACATGCCCTG

Full Affymetrix probeset data:

Annotations for 1641686_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720