Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641687_at:

>probe:Drosophila_2:1641687_at:692:297; Interrogation_Position=143; Antisense; CGCATATTACTGCTAGGTCTGGATA
>probe:Drosophila_2:1641687_at:558:49; Interrogation_Position=168; Antisense; ATGCCGGCAAGACGACAATCCTGAA
>probe:Drosophila_2:1641687_at:174:379; Interrogation_Position=190; Antisense; GAAGCGCTTTAATGGCGAACCCATA
>probe:Drosophila_2:1641687_at:317:357; Interrogation_Position=259; Antisense; GCACAACGGCTACACCCTGAATATG
>probe:Drosophila_2:1641687_at:387:219; Interrogation_Position=302; Antisense; AAGTCTCTGCGATCCTACTGGAGAA
>probe:Drosophila_2:1641687_at:682:423; Interrogation_Position=322; Antisense; GAGAAACTACTTCGAGTCCACTGAT
>probe:Drosophila_2:1641687_at:350:87; Interrogation_Position=336; Antisense; AGTCCACTGATGGTCTGGTCTGGGT
>probe:Drosophila_2:1641687_at:338:103; Interrogation_Position=427; Antisense; AGAGCGATTAGCTGGAGCCACACTC
>probe:Drosophila_2:1641687_at:456:157; Interrogation_Position=446; Antisense; ACACTCCTAGTTCTCTGCAACAAAC
>probe:Drosophila_2:1641687_at:563:179; Interrogation_Position=467; Antisense; AAACAGGATCTACCGGGAGCCCTCT
>probe:Drosophila_2:1641687_at:670:271; Interrogation_Position=539; Antisense; CATCATTGGCTGGTGGCCGGAGTTA
>probe:Drosophila_2:1641687_at:429:581; Interrogation_Position=574; Antisense; TGGCGAGAAACTGCTTAGCTCCATG
>probe:Drosophila_2:1641687_at:417:629; Interrogation_Position=593; Antisense; TCCATGGACTGGTTGATCGCCGATA
>probe:Drosophila_2:1641687_at:225:699; Interrogation_Position=658; Antisense; TTTACTTCCTTATTTCTCGACCAAG

Paste this into a BLAST search page for me
CGCATATTACTGCTAGGTCTGGATAATGCCGGCAAGACGACAATCCTGAAGAAGCGCTTTAATGGCGAACCCATAGCACAACGGCTACACCCTGAATATGAAGTCTCTGCGATCCTACTGGAGAAGAGAAACTACTTCGAGTCCACTGATAGTCCACTGATGGTCTGGTCTGGGTAGAGCGATTAGCTGGAGCCACACTCACACTCCTAGTTCTCTGCAACAAACAAACAGGATCTACCGGGAGCCCTCTCATCATTGGCTGGTGGCCGGAGTTATGGCGAGAAACTGCTTAGCTCCATGTCCATGGACTGGTTGATCGCCGATATTTACTTCCTTATTTCTCGACCAAG

Full Affymetrix probeset data:

Annotations for 1641687_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime