FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641688_at:

>probe:Drosophila_2:1641688_at:298:687; Interrogation_Position=1242; Antisense; TATATCACTGAATCCCCTTCTAAAC
>probe:Drosophila_2:1641688_at:141:179; Interrogation_Position=1263; Antisense; AAACTCTGCGCCCTGGAAGTGTCAG
>probe:Drosophila_2:1641688_at:234:541; Interrogation_Position=1320; Antisense; GGTTACCTCAGATGCGGAGCTTCAG
>probe:Drosophila_2:1641688_at:299:363; Interrogation_Position=1390; Antisense; GAATTCATTTATCGCCATCGTGCTG
>probe:Drosophila_2:1641688_at:723:41; Interrogation_Position=1406; Antisense; ATCGTGCTGATCTCCATGAGACCAA
>probe:Drosophila_2:1641688_at:412:423; Interrogation_Position=1423; Antisense; GAGACCAATACCCACATTTTGCAGG
>probe:Drosophila_2:1641688_at:673:23; Interrogation_Position=1452; Antisense; ATATGCTCTCACTCAACTATACGGA
>probe:Drosophila_2:1641688_at:91:373; Interrogation_Position=1475; Antisense; GAAGTGCTCCGGGATTCGCAATGGA
>probe:Drosophila_2:1641688_at:36:437; Interrogation_Position=1543; Antisense; GAGGAACTCCTTAAACTGGCCGACA
>probe:Drosophila_2:1641688_at:223:143; Interrogation_Position=1557; Antisense; ACTGGCCGACATTTTCGATGGCGGT
>probe:Drosophila_2:1641688_at:425:377; Interrogation_Position=1621; Antisense; GAAGCTTTAGTGACGCAGGCTCTGC
>probe:Drosophila_2:1641688_at:445:281; Interrogation_Position=1642; Antisense; CTGCGCTCGAAAGACCCATTGGATT
>probe:Drosophila_2:1641688_at:424:497; Interrogation_Position=1765; Antisense; GTCATTTTGAGTTCTGCGCTTGAGC
>probe:Drosophila_2:1641688_at:304:323; Interrogation_Position=1780; Antisense; GCGCTTGAGCGCTTTGAACCAGTTG

Paste this into a BLAST search page for me
TATATCACTGAATCCCCTTCTAAACAAACTCTGCGCCCTGGAAGTGTCAGGGTTACCTCAGATGCGGAGCTTCAGGAATTCATTTATCGCCATCGTGCTGATCGTGCTGATCTCCATGAGACCAAGAGACCAATACCCACATTTTGCAGGATATGCTCTCACTCAACTATACGGAGAAGTGCTCCGGGATTCGCAATGGAGAGGAACTCCTTAAACTGGCCGACAACTGGCCGACATTTTCGATGGCGGTGAAGCTTTAGTGACGCAGGCTCTGCCTGCGCTCGAAAGACCCATTGGATTGTCATTTTGAGTTCTGCGCTTGAGCGCGCTTGAGCGCTTTGAACCAGTTG

Full Affymetrix probeset data:

Annotations for 1641688_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720