FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641689_at:

>probe:Drosophila_2:1641689_at:515:273; Interrogation_Position=1043; Antisense; CATTGGAGCTGACGCTATTCTGCCG
>probe:Drosophila_2:1641689_at:431:361; Interrogation_Position=1108; Antisense; GCAATAGACTTAGCGTGACCTTTAA
>probe:Drosophila_2:1641689_at:51:513; Interrogation_Position=1122; Antisense; GTGACCTTTAACGAGCATGCCGAGG
>probe:Drosophila_2:1641689_at:363:113; Interrogation_Position=1174; Antisense; AGCAGTGCATCGTGGACATTCTGGA
>probe:Drosophila_2:1641689_at:296:337; Interrogation_Position=1210; Antisense; GCTCCGTTTACTTGCGCACAAAATA
>probe:Drosophila_2:1641689_at:336:163; Interrogation_Position=1243; Antisense; AAATATTTACCTTCCAGCTGCGGGA
>probe:Drosophila_2:1641689_at:385:243; Interrogation_Position=1285; Antisense; AATTTGATGACAAGGCCGGCACGGT
>probe:Drosophila_2:1641689_at:92:611; Interrogation_Position=1309; Antisense; TGACTGTGGTTCAGGTCCGGCGCAA
>probe:Drosophila_2:1641689_at:706:631; Interrogation_Position=1324; Antisense; TCCGGCGCAACGAGAATGTCCAGGT
>probe:Drosophila_2:1641689_at:714:323; Interrogation_Position=1370; Antisense; GCGCAGCGCCTAACTTATGGATTAT
>probe:Drosophila_2:1641689_at:285:409; Interrogation_Position=1452; Antisense; GAGCTTTAACCTTTGGCGTTTCAAT
>probe:Drosophila_2:1641689_at:27:681; Interrogation_Position=1508; Antisense; TATGTATGAGGCTTGTTTCCCACGC
>probe:Drosophila_2:1641689_at:445:587; Interrogation_Position=935; Antisense; TGGACCGCATGAGAGCAGCCTGGAC
>probe:Drosophila_2:1641689_at:434:557; Interrogation_Position=956; Antisense; GGACTTCTACGACTCCAGACAGGAG

Paste this into a BLAST search page for me
CATTGGAGCTGACGCTATTCTGCCGGCAATAGACTTAGCGTGACCTTTAAGTGACCTTTAACGAGCATGCCGAGGAGCAGTGCATCGTGGACATTCTGGAGCTCCGTTTACTTGCGCACAAAATAAAATATTTACCTTCCAGCTGCGGGAAATTTGATGACAAGGCCGGCACGGTTGACTGTGGTTCAGGTCCGGCGCAATCCGGCGCAACGAGAATGTCCAGGTGCGCAGCGCCTAACTTATGGATTATGAGCTTTAACCTTTGGCGTTTCAATTATGTATGAGGCTTGTTTCCCACGCTGGACCGCATGAGAGCAGCCTGGACGGACTTCTACGACTCCAGACAGGAG

Full Affymetrix probeset data:

Annotations for 1641689_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720