Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641692_at:

>probe:Drosophila_2:1641692_at:440:295; Interrogation_Position=1309; Antisense; CGAGGAGCAGCGTCAGGCGAACAAT
>probe:Drosophila_2:1641692_at:30:575; Interrogation_Position=1393; Antisense; GGCGGCGGAAGCTGCAGCATCCACA
>probe:Drosophila_2:1641692_at:724:471; Interrogation_Position=1439; Antisense; GTTCAGGAATCAGCCGCAACGGAGT
>probe:Drosophila_2:1641692_at:701:351; Interrogation_Position=1481; Antisense; GCAGCGGGTGATGCCTCAAACGTTA
>probe:Drosophila_2:1641692_at:179:413; Interrogation_Position=1522; Antisense; GACCGTTGACATTGCGACAGACACC
>probe:Drosophila_2:1641692_at:665:397; Interrogation_Position=1537; Antisense; GACAGACACCCAGGAGCTCGTAGGT
>probe:Drosophila_2:1641692_at:36:339; Interrogation_Position=1552; Antisense; GCTCGTAGGTGATGGCGACGCTATC
>probe:Drosophila_2:1641692_at:681:339; Interrogation_Position=1571; Antisense; GCTATCACCGCAAAGTCACTTGTTG
>probe:Drosophila_2:1641692_at:470:467; Interrogation_Position=1592; Antisense; GTTGATATATCCGAAGTGCCTCCCC
>probe:Drosophila_2:1641692_at:653:661; Interrogation_Position=1637; Antisense; TAAACTACTGACTGTTCGCCTATAG
>probe:Drosophila_2:1641692_at:584:203; Interrogation_Position=1690; Antisense; AAGCCTTCCCTGCAAAGCATTTTGT
>probe:Drosophila_2:1641692_at:341:345; Interrogation_Position=1706; Antisense; GCATTTTGTGTCATCCATGTCTCAA
>probe:Drosophila_2:1641692_at:480:267; Interrogation_Position=1759; Antisense; CATGGTCCGAATTTTGTACTAGTTA
>probe:Drosophila_2:1641692_at:554:291; Interrogation_Position=1823; Antisense; CGTCGGTGATCGTGTATTGCTGTTC

Paste this into a BLAST search page for me
CGAGGAGCAGCGTCAGGCGAACAATGGCGGCGGAAGCTGCAGCATCCACAGTTCAGGAATCAGCCGCAACGGAGTGCAGCGGGTGATGCCTCAAACGTTAGACCGTTGACATTGCGACAGACACCGACAGACACCCAGGAGCTCGTAGGTGCTCGTAGGTGATGGCGACGCTATCGCTATCACCGCAAAGTCACTTGTTGGTTGATATATCCGAAGTGCCTCCCCTAAACTACTGACTGTTCGCCTATAGAAGCCTTCCCTGCAAAGCATTTTGTGCATTTTGTGTCATCCATGTCTCAACATGGTCCGAATTTTGTACTAGTTACGTCGGTGATCGTGTATTGCTGTTC

Full Affymetrix probeset data:

Annotations for 1641692_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime