Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641695_a_at:

>probe:Drosophila_2:1641695_a_at:13:543; Interrogation_Position=1019; Antisense; GGATTGTCCTTCTCATGATGCAGCG
>probe:Drosophila_2:1641695_a_at:190:607; Interrogation_Position=1034; Antisense; TGATGCAGCGCTTTAATTCCCCGAT
>probe:Drosophila_2:1641695_a_at:62:13; Interrogation_Position=572; Antisense; ATATAACCTACGACTCGGTGGCCTA
>probe:Drosophila_2:1641695_a_at:160:667; Interrogation_Position=595; Antisense; TACTCGTTGCTCTGTTTCTTGAAGG
>probe:Drosophila_2:1641695_a_at:685:339; Interrogation_Position=624; Antisense; GCTACAAATGCTGGTCCTGCGATTA
>probe:Drosophila_2:1641695_a_at:584:561; Interrogation_Position=699; Antisense; GGAACTGCGTGAGTGTGCCGCCTAC
>probe:Drosophila_2:1641695_a_at:163:543; Interrogation_Position=731; Antisense; GGATTGTTCGTTTCAAGGACCTGGT
>probe:Drosophila_2:1641695_a_at:32:41; Interrogation_Position=780; Antisense; ATCTGTGCAGCTCATGTGTTCTGTT
>probe:Drosophila_2:1641695_a_at:37:593; Interrogation_Position=806; Antisense; TGGTGCTGGTGTCCAACCTGTACGA
>probe:Drosophila_2:1641695_a_at:216:289; Interrogation_Position=855; Antisense; CGGCGATGCCATCTTTATGCTCAAG
>probe:Drosophila_2:1641695_a_at:13:39; Interrogation_Position=886; Antisense; ATCTATCAGCTGGTGATGCTCTGGC
>probe:Drosophila_2:1641695_a_at:390:53; Interrogation_Position=901; Antisense; ATGCTCTGGCAGATCTTCATCATTT
>probe:Drosophila_2:1641695_a_at:331:491; Interrogation_Position=943; Antisense; GTAACTGTCCAGAGCTCTAGGTTGT
>probe:Drosophila_2:1641695_a_at:518:541; Interrogation_Position=962; Antisense; GGTTGTGTCACAGCATCTACAGCTC

Paste this into a BLAST search page for me
GGATTGTCCTTCTCATGATGCAGCGTGATGCAGCGCTTTAATTCCCCGATATATAACCTACGACTCGGTGGCCTATACTCGTTGCTCTGTTTCTTGAAGGGCTACAAATGCTGGTCCTGCGATTAGGAACTGCGTGAGTGTGCCGCCTACGGATTGTTCGTTTCAAGGACCTGGTATCTGTGCAGCTCATGTGTTCTGTTTGGTGCTGGTGTCCAACCTGTACGACGGCGATGCCATCTTTATGCTCAAGATCTATCAGCTGGTGATGCTCTGGCATGCTCTGGCAGATCTTCATCATTTGTAACTGTCCAGAGCTCTAGGTTGTGGTTGTGTCACAGCATCTACAGCTC

Full Affymetrix probeset data:

Annotations for 1641695_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime