Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641697_at:

>probe:Drosophila_2:1641697_at:686:341; Interrogation_Position=3604; Antisense; GCTTTAGATTTTCTCAGCGTTTTAA
>probe:Drosophila_2:1641697_at:113:485; Interrogation_Position=3660; Antisense; GTAGATCGATAAATGCATGACCAGA
>probe:Drosophila_2:1641697_at:179:231; Interrogation_Position=3671; Antisense; AATGCATGACCAGAAACTTTCAACA
>probe:Drosophila_2:1641697_at:5:653; Interrogation_Position=3690; Antisense; TCAACAACACACAATTCACCACAAA
>probe:Drosophila_2:1641697_at:608:181; Interrogation_Position=3712; Antisense; AAAACCCACCCATTGTTGCAAGCCG
>probe:Drosophila_2:1641697_at:103:469; Interrogation_Position=3726; Antisense; GTTGCAAGCCGTATACCAAAGTCTA
>probe:Drosophila_2:1641697_at:305:483; Interrogation_Position=3736; Antisense; GTATACCAAAGTCTATTCTCATCTA
>probe:Drosophila_2:1641697_at:678:251; Interrogation_Position=3772; Antisense; CAAACCCGATTTTGATCTGGGCATA
>probe:Drosophila_2:1641697_at:695:449; Interrogation_Position=3785; Antisense; GATCTGGGCATAAGTTTACCTCAAC
>probe:Drosophila_2:1641697_at:233:477; Interrogation_Position=3798; Antisense; GTTTACCTCAACTGAAAGCTCCGAT
>probe:Drosophila_2:1641697_at:562:333; Interrogation_Position=3815; Antisense; GCTCCGATAGCCTGTACAATATACA
>probe:Drosophila_2:1641697_at:692:15; Interrogation_Position=3877; Antisense; ATTTCATCGATTGCAAAGTGGATAC
>probe:Drosophila_2:1641697_at:502:221; Interrogation_Position=3913; Antisense; AAGGGCAATTCCCAGAAAGCAATTA
>probe:Drosophila_2:1641697_at:238:699; Interrogation_Position=4132; Antisense; TTTTGCGTGTGTAAACCGTTTATGC

Paste this into a BLAST search page for me
GCTTTAGATTTTCTCAGCGTTTTAAGTAGATCGATAAATGCATGACCAGAAATGCATGACCAGAAACTTTCAACATCAACAACACACAATTCACCACAAAAAAACCCACCCATTGTTGCAAGCCGGTTGCAAGCCGTATACCAAAGTCTAGTATACCAAAGTCTATTCTCATCTACAAACCCGATTTTGATCTGGGCATAGATCTGGGCATAAGTTTACCTCAACGTTTACCTCAACTGAAAGCTCCGATGCTCCGATAGCCTGTACAATATACAATTTCATCGATTGCAAAGTGGATACAAGGGCAATTCCCAGAAAGCAATTATTTTGCGTGTGTAAACCGTTTATGC

Full Affymetrix probeset data:

Annotations for 1641697_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime