FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641698_at:

>probe:Drosophila_2:1641698_at:284:571; Interrogation_Position=106; Antisense; GGCTCACATTCGTTGGCATTTGGGT
>probe:Drosophila_2:1641698_at:644:343; Interrogation_Position=121; Antisense; GCATTTGGGTTCAAGCCGAGGTCCA
>probe:Drosophila_2:1641698_at:511:583; Interrogation_Position=233; Antisense; TGGCATTTTCAGGATCACTTGGGAT
>probe:Drosophila_2:1641698_at:370:567; Interrogation_Position=273; Antisense; GGCAGATTGACCATACCTGGCGACT
>probe:Drosophila_2:1641698_at:169:583; Interrogation_Position=290; Antisense; TGGCGACTCGCCATTGACGGATAGT
>probe:Drosophila_2:1641698_at:702:25; Interrogation_Position=310; Antisense; ATAGTTCTTTTACCAACTGCGCCAA
>probe:Drosophila_2:1641698_at:158:251; Interrogation_Position=332; Antisense; CAATGATCCGTATTGTGCGGCCGAT
>probe:Drosophila_2:1641698_at:695:331; Interrogation_Position=348; Antisense; GCGGCCGATACTTTGCAGAGTTATA
>probe:Drosophila_2:1641698_at:677:435; Interrogation_Position=411; Antisense; GAGGACTGTTACGATTATGGTGCCA
>probe:Drosophila_2:1641698_at:78:687; Interrogation_Position=441; Antisense; TATATGGGTCCCTTCAACTGCAAGG
>probe:Drosophila_2:1641698_at:370:541; Interrogation_Position=467; Antisense; GGATATGCCCTACACCTACGAGAGC
>probe:Drosophila_2:1641698_at:697:327; Interrogation_Position=533; Antisense; GCGTCAGAATTCCAGCTAGGCCTAA
>probe:Drosophila_2:1641698_at:337:339; Interrogation_Position=547; Antisense; GCTAGGCCTAATGCAACTTTTTCTA
>probe:Drosophila_2:1641698_at:432:15; Interrogation_Position=89; Antisense; ATTATTTTTCGTACTCGGGCTCACA

Paste this into a BLAST search page for me
GGCTCACATTCGTTGGCATTTGGGTGCATTTGGGTTCAAGCCGAGGTCCATGGCATTTTCAGGATCACTTGGGATGGCAGATTGACCATACCTGGCGACTTGGCGACTCGCCATTGACGGATAGTATAGTTCTTTTACCAACTGCGCCAACAATGATCCGTATTGTGCGGCCGATGCGGCCGATACTTTGCAGAGTTATAGAGGACTGTTACGATTATGGTGCCATATATGGGTCCCTTCAACTGCAAGGGGATATGCCCTACACCTACGAGAGCGCGTCAGAATTCCAGCTAGGCCTAAGCTAGGCCTAATGCAACTTTTTCTAATTATTTTTCGTACTCGGGCTCACA

Full Affymetrix probeset data:

Annotations for 1641698_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720