Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641699_at:

>probe:Drosophila_2:1641699_at:422:355; Interrogation_Position=1914; Antisense; GCACGGGCGGCATGACACTGAACTT
>probe:Drosophila_2:1641699_at:345:653; Interrogation_Position=1957; Antisense; TCAAGCCGAATTAGAGTCCGCCAAT
>probe:Drosophila_2:1641699_at:455:437; Interrogation_Position=2024; Antisense; GAGGAGTTCCGCGATGTGTGCTACA
>probe:Drosophila_2:1641699_at:102:517; Interrogation_Position=2039; Antisense; GTGTGCTACATGCTGCTAGGCTATA
>probe:Drosophila_2:1641699_at:251:637; Interrogation_Position=2067; Antisense; TCGATCGAATCGGTGCCAACAGCAA
>probe:Drosophila_2:1641699_at:42:83; Interrogation_Position=2118; Antisense; AGGGACCGGATGACTATCTGGACAT
>probe:Drosophila_2:1641699_at:495:585; Interrogation_Position=2136; Antisense; TGGACATCAGCCTCAACGAATCGAA
>probe:Drosophila_2:1641699_at:656:235; Interrogation_Position=2154; Antisense; AATCGAACTGTTTGGCGCTACTGGA
>probe:Drosophila_2:1641699_at:88:589; Interrogation_Position=2175; Antisense; TGGAGTCGCCATATTCGCACACATT
>probe:Drosophila_2:1641699_at:204:49; Interrogation_Position=2202; Antisense; ATCCACCTATTGATCAGCAGCTGGC
>probe:Drosophila_2:1641699_at:503:7; Interrogation_Position=2272; Antisense; ATTCCAAAAGGCCACTGTCACGATG
>probe:Drosophila_2:1641699_at:554:537; Interrogation_Position=2302; Antisense; GGTCATCATTACTTTAGTCTGTCTT
>probe:Drosophila_2:1641699_at:565:389; Interrogation_Position=2356; Antisense; GAAACTTATTCTTGTCCGCATCAGA
>probe:Drosophila_2:1641699_at:96:339; Interrogation_Position=2408; Antisense; GCTAACAATAAACTTCCCCACATAT

Paste this into a BLAST search page for me
GCACGGGCGGCATGACACTGAACTTTCAAGCCGAATTAGAGTCCGCCAATGAGGAGTTCCGCGATGTGTGCTACAGTGTGCTACATGCTGCTAGGCTATATCGATCGAATCGGTGCCAACAGCAAAGGGACCGGATGACTATCTGGACATTGGACATCAGCCTCAACGAATCGAAAATCGAACTGTTTGGCGCTACTGGATGGAGTCGCCATATTCGCACACATTATCCACCTATTGATCAGCAGCTGGCATTCCAAAAGGCCACTGTCACGATGGGTCATCATTACTTTAGTCTGTCTTGAAACTTATTCTTGTCCGCATCAGAGCTAACAATAAACTTCCCCACATAT

Full Affymetrix probeset data:

Annotations for 1641699_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime