FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641700_at:

>probe:Drosophila_2:1641700_at:44:131; Interrogation_Position=1015; Antisense; ACCGTTTGCAGTTCCAAGGTCACTG
>probe:Drosophila_2:1641700_at:597:223; Interrogation_Position=1030; Antisense; AAGGTCACTGGACACTGCATCCAAT
>probe:Drosophila_2:1641700_at:172:349; Interrogation_Position=1061; Antisense; GCAGCTCCTCCGTGTAACCAATAAG
>probe:Drosophila_2:1641700_at:498:151; Interrogation_Position=1091; Antisense; ACATTTTTCGCGGTGTAATCGCCTG
>probe:Drosophila_2:1641700_at:435:27; Interrogation_Position=1120; Antisense; ATAAGGGCCGCGATCCTAATGGTGT
>probe:Drosophila_2:1641700_at:1:49; Interrogation_Position=1132; Antisense; ATCCTAATGGTGTTGTGCTGTCGCT
>probe:Drosophila_2:1641700_at:580:619; Interrogation_Position=1147; Antisense; TGCTGTCGCTTGATAATGACCTCGG
>probe:Drosophila_2:1641700_at:382:627; Interrogation_Position=1186; Antisense; TGCCATGTGCCGGTGACAAACTTGC
>probe:Drosophila_2:1641700_at:472:445; Interrogation_Position=1212; Antisense; GATGAACACATCCTCTATGGCGGTC
>probe:Drosophila_2:1641700_at:602:349; Interrogation_Position=1247; Antisense; GCAGGGCATCCTTCATTGTTGCTAA
>probe:Drosophila_2:1641700_at:201:533; Interrogation_Position=1279; Antisense; GGTGGCCATCAAAATGCTTCCTTAA
>probe:Drosophila_2:1641700_at:617:93; Interrogation_Position=749; Antisense; AGATTGTTGTTTTCCTGTTTGTAGA
>probe:Drosophila_2:1641700_at:542:323; Interrogation_Position=911; Antisense; GCGAAGTCGAGTACACGCACTAAGT
>probe:Drosophila_2:1641700_at:683:721; Interrogation_Position=988; Antisense; TTGAAGACCACGTCCTTTTTATCGC

Paste this into a BLAST search page for me
ACCGTTTGCAGTTCCAAGGTCACTGAAGGTCACTGGACACTGCATCCAATGCAGCTCCTCCGTGTAACCAATAAGACATTTTTCGCGGTGTAATCGCCTGATAAGGGCCGCGATCCTAATGGTGTATCCTAATGGTGTTGTGCTGTCGCTTGCTGTCGCTTGATAATGACCTCGGTGCCATGTGCCGGTGACAAACTTGCGATGAACACATCCTCTATGGCGGTCGCAGGGCATCCTTCATTGTTGCTAAGGTGGCCATCAAAATGCTTCCTTAAAGATTGTTGTTTTCCTGTTTGTAGAGCGAAGTCGAGTACACGCACTAAGTTTGAAGACCACGTCCTTTTTATCGC

Full Affymetrix probeset data:

Annotations for 1641700_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720