FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641701_at:

>probe:Drosophila_2:1641701_at:486:303; Interrogation_Position=166; Antisense; CCGGGCGTTCTGCATACGATAACAT
>probe:Drosophila_2:1641701_at:25:403; Interrogation_Position=206; Antisense; GACATTGCCCGAAGGTTTTCCGGCA
>probe:Drosophila_2:1641701_at:370:627; Interrogation_Position=233; Antisense; TGCCTATGCTGCTTATGCCGCTGGT
>probe:Drosophila_2:1641701_at:729:295; Interrogation_Position=251; Antisense; CGCTGGTCGCGGATACTCGGGCTAT
>probe:Drosophila_2:1641701_at:478:25; Interrogation_Position=263; Antisense; ATACTCGGGCTATCCCAGTTTTGGA
>probe:Drosophila_2:1641701_at:132:685; Interrogation_Position=273; Antisense; TATCCCAGTTTTGGACTGCCCTATC
>probe:Drosophila_2:1641701_at:595:283; Interrogation_Position=288; Antisense; CTGCCCTATCCAACTGTTGATCTAA
>probe:Drosophila_2:1641701_at:342:451; Interrogation_Position=306; Antisense; GATCTAACCAATGGGCAGCTGACAC
>probe:Drosophila_2:1641701_at:459:411; Interrogation_Position=353; Antisense; GACCCAGGCGCTGTCAGGTGATGAT
>probe:Drosophila_2:1641701_at:471:445; Interrogation_Position=375; Antisense; GATGAACAACTATCAGGCGGCTGCT
>probe:Drosophila_2:1641701_at:288:129; Interrogation_Position=499; Antisense; ACCATCGACATGTACAGCTCGGCGG
>probe:Drosophila_2:1641701_at:141:303; Interrogation_Position=524; Antisense; CCGCCGACAATGTGGGCTATGTGCA
>probe:Drosophila_2:1641701_at:538:383; Interrogation_Position=603; Antisense; GAACTACAGCCCGATTTATTCGTTG
>probe:Drosophila_2:1641701_at:188:11; Interrogation_Position=620; Antisense; ATTCGTTGAACTTTGCGATGGCTAA

Paste this into a BLAST search page for me
CCGGGCGTTCTGCATACGATAACATGACATTGCCCGAAGGTTTTCCGGCATGCCTATGCTGCTTATGCCGCTGGTCGCTGGTCGCGGATACTCGGGCTATATACTCGGGCTATCCCAGTTTTGGATATCCCAGTTTTGGACTGCCCTATCCTGCCCTATCCAACTGTTGATCTAAGATCTAACCAATGGGCAGCTGACACGACCCAGGCGCTGTCAGGTGATGATGATGAACAACTATCAGGCGGCTGCTACCATCGACATGTACAGCTCGGCGGCCGCCGACAATGTGGGCTATGTGCAGAACTACAGCCCGATTTATTCGTTGATTCGTTGAACTTTGCGATGGCTAA

Full Affymetrix probeset data:

Annotations for 1641701_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720