FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641702_at:

>probe:Drosophila_2:1641702_at:391:449; Interrogation_Position=2680; Antisense; GATCCGATGGATAACTTGCTATTCA
>probe:Drosophila_2:1641702_at:641:687; Interrogation_Position=2699; Antisense; TATTCAAGTTGAGTTTCCTGCGTCT
>probe:Drosophila_2:1641702_at:608:327; Interrogation_Position=2718; Antisense; GCGTCTCGGTCAATTAGCCTTACAA
>probe:Drosophila_2:1641702_at:183:695; Interrogation_Position=2784; Antisense; TTTGCCTGCCAGACGCAAGAACTTT
>probe:Drosophila_2:1641702_at:349:679; Interrogation_Position=2818; Antisense; TATGGAATGGGCCTGACACTGTACC
>probe:Drosophila_2:1641702_at:588:157; Interrogation_Position=2833; Antisense; ACACTGTACCATCTCAATCGTCTTG
>probe:Drosophila_2:1641702_at:63:43; Interrogation_Position=2849; Antisense; ATCGTCTTGAGGAAGCCATTCCGTA
>probe:Drosophila_2:1641702_at:453:9; Interrogation_Position=2866; Antisense; ATTCCGTATCTATCGCGTTGCACAG
>probe:Drosophila_2:1641702_at:694:327; Interrogation_Position=2880; Antisense; GCGTTGCACAGAAGTCGACATCTTT
>probe:Drosophila_2:1641702_at:51:271; Interrogation_Position=2934; Antisense; CATTAACCTACGACTGAGCCGAAAT
>probe:Drosophila_2:1641702_at:379:569; Interrogation_Position=2984; Antisense; TGGCTAAACTGTACCCCGAAGTAAG
>probe:Drosophila_2:1641702_at:402:357; Interrogation_Position=3014; Antisense; GCAAAAGCGTTTATGCCGAACTTGA
>probe:Drosophila_2:1641702_at:542:89; Interrogation_Position=3047; Antisense; AGTACTCGGATGTACATCTCCTTGT
>probe:Drosophila_2:1641702_at:722:253; Interrogation_Position=3140; Antisense; CAAAAGGCTTTGCAGTTACCCAAGA

Paste this into a BLAST search page for me
GATCCGATGGATAACTTGCTATTCATATTCAAGTTGAGTTTCCTGCGTCTGCGTCTCGGTCAATTAGCCTTACAATTTGCCTGCCAGACGCAAGAACTTTTATGGAATGGGCCTGACACTGTACCACACTGTACCATCTCAATCGTCTTGATCGTCTTGAGGAAGCCATTCCGTAATTCCGTATCTATCGCGTTGCACAGGCGTTGCACAGAAGTCGACATCTTTCATTAACCTACGACTGAGCCGAAATTGGCTAAACTGTACCCCGAAGTAAGGCAAAAGCGTTTATGCCGAACTTGAAGTACTCGGATGTACATCTCCTTGTCAAAAGGCTTTGCAGTTACCCAAGA

Full Affymetrix probeset data:

Annotations for 1641702_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720