Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641703_at:

>probe:Drosophila_2:1641703_at:678:525; Interrogation_Position=180; Antisense; GGGCAAATCATAGCTCCATCGGGAG
>probe:Drosophila_2:1641703_at:45:639; Interrogation_Position=198; Antisense; TCGGGAGCGTTTCCTGGATCCCTGA
>probe:Drosophila_2:1641703_at:83:19; Interrogation_Position=249; Antisense; ATTTCGGCGGATTCTCAGAGCTGCA
>probe:Drosophila_2:1641703_at:342:179; Interrogation_Position=278; Antisense; AAACAATAGTCGTCCACGCCTAGAT
>probe:Drosophila_2:1641703_at:40:679; Interrogation_Position=298; Antisense; TAGATCTTCGCAAGCGCGTGGCCCA
>probe:Drosophila_2:1641703_at:207:373; Interrogation_Position=335; Antisense; GAAGTCCTCTAGTGTCCAGCTGGTT
>probe:Drosophila_2:1641703_at:147:333; Interrogation_Position=353; Antisense; GCTGGTTCAGCCACAACTATCAATA
>probe:Drosophila_2:1641703_at:697:111; Interrogation_Position=383; Antisense; AGCACAAGATTCAATCTCGCCGCGT
>probe:Drosophila_2:1641703_at:325:123; Interrogation_Position=430; Antisense; AGCGCCAGATTCCATATCCGGATCC
>probe:Drosophila_2:1641703_at:357:479; Interrogation_Position=490; Antisense; GTTTCGGAGCGGGACCAAATGCCAA
>probe:Drosophila_2:1641703_at:50:449; Interrogation_Position=555; Antisense; GATCCCTCCAGGGTGGCCAAGGTTC
>probe:Drosophila_2:1641703_at:154:485; Interrogation_Position=600; Antisense; GTAGTTATCGCCAATTCAGGGCCTA
>probe:Drosophila_2:1641703_at:534:265; Interrogation_Position=616; Antisense; CAGGGCCTAGGCTAAGGAACTTCAA
>probe:Drosophila_2:1641703_at:431:13; Interrogation_Position=641; Antisense; ATTAATGTGTTCTATGGCGGGCTGG

Paste this into a BLAST search page for me
GGGCAAATCATAGCTCCATCGGGAGTCGGGAGCGTTTCCTGGATCCCTGAATTTCGGCGGATTCTCAGAGCTGCAAAACAATAGTCGTCCACGCCTAGATTAGATCTTCGCAAGCGCGTGGCCCAGAAGTCCTCTAGTGTCCAGCTGGTTGCTGGTTCAGCCACAACTATCAATAAGCACAAGATTCAATCTCGCCGCGTAGCGCCAGATTCCATATCCGGATCCGTTTCGGAGCGGGACCAAATGCCAAGATCCCTCCAGGGTGGCCAAGGTTCGTAGTTATCGCCAATTCAGGGCCTACAGGGCCTAGGCTAAGGAACTTCAAATTAATGTGTTCTATGGCGGGCTGG

Full Affymetrix probeset data:

Annotations for 1641703_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime