Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641704_at:

>probe:Drosophila_2:1641704_at:710:311; Interrogation_Position=1351; Antisense; GCCAACTGCCCTTGACGACGAAGAT
>probe:Drosophila_2:1641704_at:576:197; Interrogation_Position=1379; Antisense; AACGACGACGTCATTTCAATAGGTG
>probe:Drosophila_2:1641704_at:523:407; Interrogation_Position=1439; Antisense; GACGATTCACCTTGGGTAAGCATTA
>probe:Drosophila_2:1641704_at:549:559; Interrogation_Position=1504; Antisense; GGACAACGATGTCATATCCCTGGAC
>probe:Drosophila_2:1641704_at:374:193; Interrogation_Position=1551; Antisense; AACTACAGCAGGCAGACTCCGAGTC
>probe:Drosophila_2:1641704_at:640:87; Interrogation_Position=1572; Antisense; AGTCCTGGCGTTCACGCTACATGAA
>probe:Drosophila_2:1641704_at:590:213; Interrogation_Position=1595; Antisense; AAGAGCTCCAAGGTCAGCCAGGTGC
>probe:Drosophila_2:1641704_at:139:177; Interrogation_Position=1640; Antisense; AAACGCGTCCGTGACAAGCTCAAGA
>probe:Drosophila_2:1641704_at:711:393; Interrogation_Position=1663; Antisense; GAAATCGAAGCGCACCAAAGTCACC
>probe:Drosophila_2:1641704_at:48:173; Interrogation_Position=1714; Antisense; AAAGCCGGATTCATTTACTTCCAAG
>probe:Drosophila_2:1641704_at:562:103; Interrogation_Position=1744; Antisense; AGACGGATCCATAGAGCAATACCAG
>probe:Drosophila_2:1641704_at:75:363; Interrogation_Position=1759; Antisense; GCAATACCAGGAGCTTCTGCAGCAC
>probe:Drosophila_2:1641704_at:168:643; Interrogation_Position=1774; Antisense; TCTGCAGCACCGACAGCGTAAAACT
>probe:Drosophila_2:1641704_at:341:611; Interrogation_Position=1867; Antisense; TGACGCACGGCCCTAGTTTATATGG

Paste this into a BLAST search page for me
GCCAACTGCCCTTGACGACGAAGATAACGACGACGTCATTTCAATAGGTGGACGATTCACCTTGGGTAAGCATTAGGACAACGATGTCATATCCCTGGACAACTACAGCAGGCAGACTCCGAGTCAGTCCTGGCGTTCACGCTACATGAAAAGAGCTCCAAGGTCAGCCAGGTGCAAACGCGTCCGTGACAAGCTCAAGAGAAATCGAAGCGCACCAAAGTCACCAAAGCCGGATTCATTTACTTCCAAGAGACGGATCCATAGAGCAATACCAGGCAATACCAGGAGCTTCTGCAGCACTCTGCAGCACCGACAGCGTAAAACTTGACGCACGGCCCTAGTTTATATGG

Full Affymetrix probeset data:

Annotations for 1641704_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime