FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641706_at:

>probe:Drosophila_2:1641706_at:398:371; Interrogation_Position=2194; Antisense; GAAGGCCGTGGAGTTCAGTCGCAAA
>probe:Drosophila_2:1641706_at:518:561; Interrogation_Position=2239; Antisense; GGAAGGCTTCAAACGACTGCTGGAG
>probe:Drosophila_2:1641706_at:637:9; Interrogation_Position=2296; Antisense; ATTCCGTTGCCGGTTGATCACAAAG
>probe:Drosophila_2:1641706_at:454:211; Interrogation_Position=2318; Antisense; AAGAACTCCTTCAGTTCGTGGCACA
>probe:Drosophila_2:1641706_at:361:291; Interrogation_Position=2334; Antisense; CGTGGCACAGCTATTCGACATACAG
>probe:Drosophila_2:1641706_at:390:227; Interrogation_Position=2378; Antisense; AAGGCGGAGATCTGTTGGCACAACA
>probe:Drosophila_2:1641706_at:52:583; Interrogation_Position=2469; Antisense; TGGCGATCGATTGGCATGCACTGCG
>probe:Drosophila_2:1641706_at:551:381; Interrogation_Position=2501; Antisense; GAACACTGGTTTGCGCGGTGGCACA
>probe:Drosophila_2:1641706_at:605:217; Interrogation_Position=2525; Antisense; AAGTATTCCACGCACTGCCGGATGA
>probe:Drosophila_2:1641706_at:290:211; Interrogation_Position=2553; Antisense; AAGACAGCAAGACTCGGCAGGCCAT
>probe:Drosophila_2:1641706_at:297:635; Interrogation_Position=2579; Antisense; TCGCACCATGAGTGGCACCTGAAAT
>probe:Drosophila_2:1641706_at:60:215; Interrogation_Position=2606; Antisense; AAGGTCCTGGACTGCTGGCGACGCT
>probe:Drosophila_2:1641706_at:436:411; Interrogation_Position=2625; Antisense; GACGCTTGCCGCAAATCCTGAAGAT
>probe:Drosophila_2:1641706_at:253:243; Interrogation_Position=2692; Antisense; AATATGGGAGCTCTTGCCTGACTAC

Paste this into a BLAST search page for me
GAAGGCCGTGGAGTTCAGTCGCAAAGGAAGGCTTCAAACGACTGCTGGAGATTCCGTTGCCGGTTGATCACAAAGAAGAACTCCTTCAGTTCGTGGCACACGTGGCACAGCTATTCGACATACAGAAGGCGGAGATCTGTTGGCACAACATGGCGATCGATTGGCATGCACTGCGGAACACTGGTTTGCGCGGTGGCACAAAGTATTCCACGCACTGCCGGATGAAAGACAGCAAGACTCGGCAGGCCATTCGCACCATGAGTGGCACCTGAAATAAGGTCCTGGACTGCTGGCGACGCTGACGCTTGCCGCAAATCCTGAAGATAATATGGGAGCTCTTGCCTGACTAC

Full Affymetrix probeset data:

Annotations for 1641706_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720