FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641707_at:

>probe:Drosophila_2:1641707_at:671:233; Interrogation_Position=1048; Antisense; AATGCGGACGCTTCCGATGCGGAGA
>probe:Drosophila_2:1641707_at:307:141; Interrogation_Position=1079; Antisense; ACGGCACCGGTTTCTCGATGAAGAA
>probe:Drosophila_2:1641707_at:632:199; Interrogation_Position=1104; Antisense; AACGCGCAAATAGCTCTGTATCTCT
>probe:Drosophila_2:1641707_at:529:537; Interrogation_Position=651; Antisense; GGTCTACGAACTGTGTGTCCTGGAG
>probe:Drosophila_2:1641707_at:671:597; Interrogation_Position=666; Antisense; TGTCCTGGAGACAAAGCCCGGCAAT
>probe:Drosophila_2:1641707_at:44:19; Interrogation_Position=726; Antisense; ATTTGAGGCGCCAGTCGGCTACAAG
>probe:Drosophila_2:1641707_at:103:225; Interrogation_Position=748; Antisense; AAGGATCACTCCGAAACGCAGGCAT
>probe:Drosophila_2:1641707_at:724:621; Interrogation_Position=795; Antisense; TGCTGGAACTGTTGGCGGCGAAATC
>probe:Drosophila_2:1641707_at:69:223; Interrogation_Position=865; Antisense; AAGGGTTCCGGCGTACGTCTCGATG
>probe:Drosophila_2:1641707_at:596:389; Interrogation_Position=904; Antisense; GAAAGCCAGTTGGAAACGCCGGTCG
>probe:Drosophila_2:1641707_at:39:711; Interrogation_Position=929; Antisense; TTAAGAAGGTGCTAGCCCGCGGCGT
>probe:Drosophila_2:1641707_at:423:287; Interrogation_Position=948; Antisense; CGGCGTTCCAGACTATGATTTCCAG
>probe:Drosophila_2:1641707_at:633:727; Interrogation_Position=974; Antisense; TTGGACTCATCCGTTTCGATCGCAA
>probe:Drosophila_2:1641707_at:154:451; Interrogation_Position=991; Antisense; GATCGCAACATTCGGCCTATCAGTG

Paste this into a BLAST search page for me
AATGCGGACGCTTCCGATGCGGAGAACGGCACCGGTTTCTCGATGAAGAAAACGCGCAAATAGCTCTGTATCTCTGGTCTACGAACTGTGTGTCCTGGAGTGTCCTGGAGACAAAGCCCGGCAATATTTGAGGCGCCAGTCGGCTACAAGAAGGATCACTCCGAAACGCAGGCATTGCTGGAACTGTTGGCGGCGAAATCAAGGGTTCCGGCGTACGTCTCGATGGAAAGCCAGTTGGAAACGCCGGTCGTTAAGAAGGTGCTAGCCCGCGGCGTCGGCGTTCCAGACTATGATTTCCAGTTGGACTCATCCGTTTCGATCGCAAGATCGCAACATTCGGCCTATCAGTG

Full Affymetrix probeset data:

Annotations for 1641707_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720