FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641708_at:

>probe:Drosophila_2:1641708_at:709:181; Interrogation_Position=2541; Antisense; AAAACTCAGTTCTGTTCGCCGCGAT
>probe:Drosophila_2:1641708_at:21:451; Interrogation_Position=2563; Antisense; GATCGCAGCGACTTTTGGGAAGGCA
>probe:Drosophila_2:1641708_at:345:233; Interrogation_Position=2599; Antisense; AATGCTACGGTCACTTGTGCCATAT
>probe:Drosophila_2:1641708_at:196:205; Interrogation_Position=2650; Antisense; AAGCCCGAACCGGATGAGATCTCCA
>probe:Drosophila_2:1641708_at:456:373; Interrogation_Position=2679; Antisense; GAAGTTGGCTCACAATCAGCCGGAT
>probe:Drosophila_2:1641708_at:620:545; Interrogation_Position=2700; Antisense; GGATCCACTGGTCGAGCAGCACAAA
>probe:Drosophila_2:1641708_at:350:63; Interrogation_Position=2738; Antisense; ATGTGTTGGTCAGCGCCGATTTCAA
>probe:Drosophila_2:1641708_at:524:581; Interrogation_Position=2763; Antisense; TGGCGCCATCAAGGTGTTCATCAAC
>probe:Drosophila_2:1641708_at:259:411; Interrogation_Position=2790; Antisense; GACGAAGCCGAAGCACAGCAGTCTA
>probe:Drosophila_2:1641708_at:379:657; Interrogation_Position=2818; Antisense; TACACGGCCATTGCGGATTAGTCTT
>probe:Drosophila_2:1641708_at:90:493; Interrogation_Position=2922; Antisense; GTAACTAGCGCCATTGCTGATTTGT
>probe:Drosophila_2:1641708_at:207:651; Interrogation_Position=2959; Antisense; TAATTACTAATTCCTGTCTGTCCCC
>probe:Drosophila_2:1641708_at:229:1; Interrogation_Position=2997; Antisense; GTTAATAATCCCATAATTCCCCTTG
>probe:Drosophila_2:1641708_at:675:661; Interrogation_Position=3032; Antisense; TAACAATTGCTGCTGGCGCGAACTG

Paste this into a BLAST search page for me
AAAACTCAGTTCTGTTCGCCGCGATGATCGCAGCGACTTTTGGGAAGGCAAATGCTACGGTCACTTGTGCCATATAAGCCCGAACCGGATGAGATCTCCAGAAGTTGGCTCACAATCAGCCGGATGGATCCACTGGTCGAGCAGCACAAAATGTGTTGGTCAGCGCCGATTTCAATGGCGCCATCAAGGTGTTCATCAACGACGAAGCCGAAGCACAGCAGTCTATACACGGCCATTGCGGATTAGTCTTGTAACTAGCGCCATTGCTGATTTGTTAATTACTAATTCCTGTCTGTCCCCGTTAATAATCCCATAATTCCCCTTGTAACAATTGCTGCTGGCGCGAACTG

Full Affymetrix probeset data:

Annotations for 1641708_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720