Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641711_at:

>probe:Drosophila_2:1641711_at:67:429; Interrogation_Position=1039; Antisense; GAGTTCCTTATCCAGACGTACTACG
>probe:Drosophila_2:1641711_at:179:293; Interrogation_Position=1055; Antisense; CGTACTACGCTTCCCTAAGGGACAG
>probe:Drosophila_2:1641711_at:302:303; Interrogation_Position=1080; Antisense; CCTGGAGCGGATGCACTCGGCGTTT
>probe:Drosophila_2:1641711_at:574:597; Interrogation_Position=1104; Antisense; TGTGCCCAGCTACGCGGATATTCAA
>probe:Drosophila_2:1641711_at:347:685; Interrogation_Position=1122; Antisense; TATTCAACAGGAGATCCGGGCCAGA
>probe:Drosophila_2:1641711_at:385:521; Interrogation_Position=1139; Antisense; GGGCCAGAGAACTGTACGGCTTCTT
>probe:Drosophila_2:1641711_at:147:307; Interrogation_Position=1175; Antisense; CCTTTCTGCCGATGGTGACCATGAA
>probe:Drosophila_2:1641711_at:391:437; Interrogation_Position=1204; Antisense; GAGGACTCGTACGACATCAGCATAG
>probe:Drosophila_2:1641711_at:292:599; Interrogation_Position=1235; Antisense; TGTCGGACCAGGACTTCGCCAAGAA
>probe:Drosophila_2:1641711_at:338:211; Interrogation_Position=1258; Antisense; AAGAAGGTCCAGCTGATGTTCTCCT
>probe:Drosophila_2:1641711_at:217:445; Interrogation_Position=1330; Antisense; GATGACCTGGGAATATTCGATTGAT
>probe:Drosophila_2:1641711_at:105:449; Interrogation_Position=1380; Antisense; GATCCCCAGATCCTTTAATACTTAG
>probe:Drosophila_2:1641711_at:462:421; Interrogation_Position=1412; Antisense; GAGAATTTTGCTACTTTTACCAATG
>probe:Drosophila_2:1641711_at:461:57; Interrogation_Position=1564; Antisense; ATGAGTTATGTTCTGGAGCTTTAAA

Paste this into a BLAST search page for me
GAGTTCCTTATCCAGACGTACTACGCGTACTACGCTTCCCTAAGGGACAGCCTGGAGCGGATGCACTCGGCGTTTTGTGCCCAGCTACGCGGATATTCAATATTCAACAGGAGATCCGGGCCAGAGGGCCAGAGAACTGTACGGCTTCTTCCTTTCTGCCGATGGTGACCATGAAGAGGACTCGTACGACATCAGCATAGTGTCGGACCAGGACTTCGCCAAGAAAAGAAGGTCCAGCTGATGTTCTCCTGATGACCTGGGAATATTCGATTGATGATCCCCAGATCCTTTAATACTTAGGAGAATTTTGCTACTTTTACCAATGATGAGTTATGTTCTGGAGCTTTAAA

Full Affymetrix probeset data:

Annotations for 1641711_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime