FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641712_at:

>probe:Drosophila_2:1641712_at:86:625; Interrogation_Position=1396; Antisense; TGCCGGGATGCGAACCACCAATTGT
>probe:Drosophila_2:1641712_at:310:179; Interrogation_Position=1540; Antisense; AAACAGGAGCTCTATGGGCCAGGTC
>probe:Drosophila_2:1641712_at:183:43; Interrogation_Position=1583; Antisense; ATCGAATGCTGCAGGCCCAGGTGTC
>probe:Drosophila_2:1641712_at:688:575; Interrogation_Position=1624; Antisense; GGCGATGCCAATTCACTGCTGGAGG
>probe:Drosophila_2:1641712_at:315:591; Interrogation_Position=1655; Antisense; TGGTGGACAGACACTACGCATCCGG
>probe:Drosophila_2:1641712_at:80:183; Interrogation_Position=1687; Antisense; AAAAGAGCTCTCTTGGCCACCAAAA
>probe:Drosophila_2:1641712_at:476:183; Interrogation_Position=1708; Antisense; AAAAGTGGTGCCCTGCTGGTGACAC
>probe:Drosophila_2:1641712_at:333:83; Interrogation_Position=1741; Antisense; AGTGGTGACCCATCGGAAGTCAGTC
>probe:Drosophila_2:1641712_at:489:279; Interrogation_Position=1775; Antisense; CTCGTCTCAAGCTGACTAGGGTGAT
>probe:Drosophila_2:1641712_at:436:591; Interrogation_Position=1843; Antisense; TGTGGGAGCCACAGTTTGCCGGATC
>probe:Drosophila_2:1641712_at:510:623; Interrogation_Position=1859; Antisense; TGCCGGATCCGGAGACTTGTCAATC
>probe:Drosophila_2:1641712_at:143:103; Interrogation_Position=1871; Antisense; AGACTTGTCAATCGGCATCGGTGGC
>probe:Drosophila_2:1641712_at:419:375; Interrogation_Position=1901; Antisense; GAAGCTCCCGTAAGTTTCCGTGGCG
>probe:Drosophila_2:1641712_at:315:123; Interrogation_Position=1957; Antisense; AGCGAGGGCTTGACCTATGGCTCAC

Paste this into a BLAST search page for me
TGCCGGGATGCGAACCACCAATTGTAAACAGGAGCTCTATGGGCCAGGTCATCGAATGCTGCAGGCCCAGGTGTCGGCGATGCCAATTCACTGCTGGAGGTGGTGGACAGACACTACGCATCCGGAAAAGAGCTCTCTTGGCCACCAAAAAAAAGTGGTGCCCTGCTGGTGACACAGTGGTGACCCATCGGAAGTCAGTCCTCGTCTCAAGCTGACTAGGGTGATTGTGGGAGCCACAGTTTGCCGGATCTGCCGGATCCGGAGACTTGTCAATCAGACTTGTCAATCGGCATCGGTGGCGAAGCTCCCGTAAGTTTCCGTGGCGAGCGAGGGCTTGACCTATGGCTCAC

Full Affymetrix probeset data:

Annotations for 1641712_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720