FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641714_at:

>probe:Drosophila_2:1641714_at:252:631; Interrogation_Position=1007; Antisense; TCCTGGAACGGCTATGTACGCAGTT
>probe:Drosophila_2:1641714_at:588:471; Interrogation_Position=1029; Antisense; GTTCGATTGGTACGCGATCTACTAG
>probe:Drosophila_2:1641714_at:657:435; Interrogation_Position=543; Antisense; GAGGTTGTCCGTCAGCATGTGAACA
>probe:Drosophila_2:1641714_at:203:189; Interrogation_Position=564; Antisense; AACAGCTTTTTCGAAGTGCCGCAGA
>probe:Drosophila_2:1641714_at:545:107; Interrogation_Position=586; Antisense; AGAACATTGACTTGCTCCTTAACTG
>probe:Drosophila_2:1641714_at:122:495; Interrogation_Position=667; Antisense; GTCAAGTGCTCAAAGTGCGTGCTCC
>probe:Drosophila_2:1641714_at:420:497; Interrogation_Position=685; Antisense; GTGCTCCCTGGGTAAAGACGGCTTT
>probe:Drosophila_2:1641714_at:126:105; Interrogation_Position=700; Antisense; AGACGGCTTTCTACGGCGATTACGA
>probe:Drosophila_2:1641714_at:645:717; Interrogation_Position=736; Antisense; TTCCCGGATTTGAGACTGTGACCCT
>probe:Drosophila_2:1641714_at:39:513; Interrogation_Position=753; Antisense; GTGACCCTGGGAGGATGTCGCCAAT
>probe:Drosophila_2:1641714_at:645:455; Interrogation_Position=810; Antisense; GATAGCATGGCCATTCGAGAGCGTT
>probe:Drosophila_2:1641714_at:353:425; Interrogation_Position=826; Antisense; GAGAGCGTTGCTACGATTTGCTGCC
>probe:Drosophila_2:1641714_at:671:563; Interrogation_Position=878; Antisense; GGAATGTGTTGGTCTGCGGCCACAC
>probe:Drosophila_2:1641714_at:666:573; Interrogation_Position=952; Antisense; GGCGGCTGAAGGTAGTCCACAACTA

Paste this into a BLAST search page for me
TCCTGGAACGGCTATGTACGCAGTTGTTCGATTGGTACGCGATCTACTAGGAGGTTGTCCGTCAGCATGTGAACAAACAGCTTTTTCGAAGTGCCGCAGAAGAACATTGACTTGCTCCTTAACTGGTCAAGTGCTCAAAGTGCGTGCTCCGTGCTCCCTGGGTAAAGACGGCTTTAGACGGCTTTCTACGGCGATTACGATTCCCGGATTTGAGACTGTGACCCTGTGACCCTGGGAGGATGTCGCCAATGATAGCATGGCCATTCGAGAGCGTTGAGAGCGTTGCTACGATTTGCTGCCGGAATGTGTTGGTCTGCGGCCACACGGCGGCTGAAGGTAGTCCACAACTA

Full Affymetrix probeset data:

Annotations for 1641714_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720