FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641715_at:

>probe:Drosophila_2:1641715_at:44:581; Interrogation_Position=251; Antisense; TGGCCAAGTTGTGGCATGCCGTCAA
>probe:Drosophila_2:1641715_at:625:49; Interrogation_Position=266; Antisense; ATGCCGTCAAGGTGGTGCTGTTCAA
>probe:Drosophila_2:1641715_at:724:507; Interrogation_Position=280; Antisense; GTGCTGTTCAATCTGACGGTGGTTA
>probe:Drosophila_2:1641715_at:387:139; Interrogation_Position=295; Antisense; ACGGTGGTTAACTTTCTGGTCAGCT
>probe:Drosophila_2:1641715_at:192:27; Interrogation_Position=353; Antisense; ATAGCCAGGATATCCGGGTGCTGCC
>probe:Drosophila_2:1641715_at:116:533; Interrogation_Position=368; Antisense; GGGTGCTGCCCACATTTAAGCGATC
>probe:Drosophila_2:1641715_at:378:657; Interrogation_Position=384; Antisense; TAAGCGATCCCTGCGCGATTTGGTC
>probe:Drosophila_2:1641715_at:190:405; Interrogation_Position=452; Antisense; GACTGCTGCATCACAGATCGGTGTA
>probe:Drosophila_2:1641715_at:144:209; Interrogation_Position=493; Antisense; AAGCATCACGAGTGGACGGCTCCCA
>probe:Drosophila_2:1641715_at:559:13; Interrogation_Position=526; Antisense; ATTACACTGTATGCCCATCCGGTGG
>probe:Drosophila_2:1641715_at:406:453; Interrogation_Position=661; Antisense; GATCATACGGGCTACAGTTTCCCAT
>probe:Drosophila_2:1641715_at:241:403; Interrogation_Position=712; Antisense; GACTATCACCATGCCAAGTTCAACT
>probe:Drosophila_2:1641715_at:445:157; Interrogation_Position=737; Antisense; ACAATTACGGTGTGCTCGGTTTTCT
>probe:Drosophila_2:1641715_at:669:205; Interrogation_Position=766; Antisense; AAGCTGCATGGCACATATCGCGCTC

Paste this into a BLAST search page for me
TGGCCAAGTTGTGGCATGCCGTCAAATGCCGTCAAGGTGGTGCTGTTCAAGTGCTGTTCAATCTGACGGTGGTTAACGGTGGTTAACTTTCTGGTCAGCTATAGCCAGGATATCCGGGTGCTGCCGGGTGCTGCCCACATTTAAGCGATCTAAGCGATCCCTGCGCGATTTGGTCGACTGCTGCATCACAGATCGGTGTAAAGCATCACGAGTGGACGGCTCCCAATTACACTGTATGCCCATCCGGTGGGATCATACGGGCTACAGTTTCCCATGACTATCACCATGCCAAGTTCAACTACAATTACGGTGTGCTCGGTTTTCTAAGCTGCATGGCACATATCGCGCTC

Full Affymetrix probeset data:

Annotations for 1641715_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720