FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641718_at:

>probe:Drosophila_2:1641718_at:486:569; Interrogation_Position=1009; Antisense; GGCTTTCGATTGCTTTTCGATCAGC
>probe:Drosophila_2:1641718_at:450:265; Interrogation_Position=1079; Antisense; CAGAGCCACGCGGAGAGATTGTTAT
>probe:Drosophila_2:1641718_at:131:67; Interrogation_Position=1111; Antisense; AGGTTTAACTCCATATCCTTGGCCA
>probe:Drosophila_2:1641718_at:363:253; Interrogation_Position=1179; Antisense; CAAGCTTGGCTCCATGCTACACATG
>probe:Drosophila_2:1641718_at:502:665; Interrogation_Position=1196; Antisense; TACACATGCGTGGAGTTTCCGGAGC
>probe:Drosophila_2:1641718_at:268:361; Interrogation_Position=1219; Antisense; GCAAGAGTGATAGTTCCTGGCCAAA
>probe:Drosophila_2:1641718_at:426:479; Interrogation_Position=1266; Antisense; GTTTCTAGGCAAATTTCGGCTCCCA
>probe:Drosophila_2:1641718_at:482:361; Interrogation_Position=1303; Antisense; GCAAGTTCCGTACCTGACTGTAGCG
>probe:Drosophila_2:1641718_at:460:593; Interrogation_Position=881; Antisense; TGGGTAGTGCCATTGTGGCCAGCTT
>probe:Drosophila_2:1641718_at:310:57; Interrogation_Position=908; Antisense; ATGAGAGTGTGCTCCACGATGTGGC
>probe:Drosophila_2:1641718_at:650:309; Interrogation_Position=921; Antisense; CCACGATGTGGCCAGTACTTATGCT
>probe:Drosophila_2:1641718_at:376:541; Interrogation_Position=958; Antisense; GGTTCCCAGTCACTAGATGTCTTGA
>probe:Drosophila_2:1641718_at:332:443; Interrogation_Position=973; Antisense; GATGTCTTGATGACGCTACTCTCAC
>probe:Drosophila_2:1641718_at:559:649; Interrogation_Position=994; Antisense; TCACTTGGGCGCAATGGCTTTCGAT

Paste this into a BLAST search page for me
GGCTTTCGATTGCTTTTCGATCAGCCAGAGCCACGCGGAGAGATTGTTATAGGTTTAACTCCATATCCTTGGCCACAAGCTTGGCTCCATGCTACACATGTACACATGCGTGGAGTTTCCGGAGCGCAAGAGTGATAGTTCCTGGCCAAAGTTTCTAGGCAAATTTCGGCTCCCAGCAAGTTCCGTACCTGACTGTAGCGTGGGTAGTGCCATTGTGGCCAGCTTATGAGAGTGTGCTCCACGATGTGGCCCACGATGTGGCCAGTACTTATGCTGGTTCCCAGTCACTAGATGTCTTGAGATGTCTTGATGACGCTACTCTCACTCACTTGGGCGCAATGGCTTTCGAT

Full Affymetrix probeset data:

Annotations for 1641718_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720