FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641720_at:

>probe:Drosophila_2:1641720_at:608:535; Interrogation_Position=1014; Antisense; GGTCCTTACGGAAATGTCTGGCATA
>probe:Drosophila_2:1641720_at:368:61; Interrogation_Position=1027; Antisense; ATGTCTGGCATATCGAATCCCGTAC
>probe:Drosophila_2:1641720_at:63:29; Interrogation_Position=1070; Antisense; ATACGGTGGCTTTAATGGCCCGCAC
>probe:Drosophila_2:1641720_at:260:355; Interrogation_Position=1091; Antisense; GCACGTTGAGCTTCAGTCCGAAACA
>probe:Drosophila_2:1641720_at:120:481; Interrogation_Position=1106; Antisense; GTCCGAAACACGATTCTCCATTTAG
>probe:Drosophila_2:1641720_at:80:445; Interrogation_Position=1177; Antisense; GATGACATTACGGTCCTATTGGCCA
>probe:Drosophila_2:1641720_at:437:307; Interrogation_Position=1191; Antisense; CCTATTGGCCAGTGTCGTCTAGAAT
>probe:Drosophila_2:1641720_at:134:725; Interrogation_Position=1246; Antisense; TTGAACAGCCACTTCGTAGCAAATT
>probe:Drosophila_2:1641720_at:418:105; Interrogation_Position=1357; Antisense; AGACTCTTTTCTTTTCAACTCTGCC
>probe:Drosophila_2:1641720_at:563:191; Interrogation_Position=1373; Antisense; AACTCTGCCATCACAAACCAATTTG
>probe:Drosophila_2:1641720_at:276:215; Interrogation_Position=1419; Antisense; AAGTTCGGCCTACAACTATGCCAGT
>probe:Drosophila_2:1641720_at:675:441; Interrogation_Position=904; Antisense; GATGGGCCCGAATCAGCGGATACCA
>probe:Drosophila_2:1641720_at:50:545; Interrogation_Position=921; Antisense; GGATACCATTCAATTCCCGATGCAA
>probe:Drosophila_2:1641720_at:4:393; Interrogation_Position=997; Antisense; GAAAGCTTTCTCGTGGAGGTCCTTA

Paste this into a BLAST search page for me
GGTCCTTACGGAAATGTCTGGCATAATGTCTGGCATATCGAATCCCGTACATACGGTGGCTTTAATGGCCCGCACGCACGTTGAGCTTCAGTCCGAAACAGTCCGAAACACGATTCTCCATTTAGGATGACATTACGGTCCTATTGGCCACCTATTGGCCAGTGTCGTCTAGAATTTGAACAGCCACTTCGTAGCAAATTAGACTCTTTTCTTTTCAACTCTGCCAACTCTGCCATCACAAACCAATTTGAAGTTCGGCCTACAACTATGCCAGTGATGGGCCCGAATCAGCGGATACCAGGATACCATTCAATTCCCGATGCAAGAAAGCTTTCTCGTGGAGGTCCTTA

Full Affymetrix probeset data:

Annotations for 1641720_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720