Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641721_a_at:

>probe:Drosophila_2:1641721_a_at:580:437; Interrogation_Position=131; Antisense; GAGGCCGTCTGGTGTACCAGTACGT
>probe:Drosophila_2:1641721_a_at:445:375; Interrogation_Position=156; Antisense; GAAGAAGAACCCCACTGTGCCACGC
>probe:Drosophila_2:1641721_a_at:714:597; Interrogation_Position=171; Antisense; TGTGCCACGCTGTGGTCAGTGCAAG
>probe:Drosophila_2:1641721_a_at:581:415; Interrogation_Position=232; Antisense; GAGCGTCCCAGGATGTCCAAGCGTT
>probe:Drosophila_2:1641721_a_at:590:627; Interrogation_Position=247; Antisense; TCCAAGCGTTTGAAGACCGTCTCCA
>probe:Drosophila_2:1641721_a_at:632:669; Interrogation_Position=277; Antisense; TACGGAGGTGTCCTGTGCCACAGCT
>probe:Drosophila_2:1641721_a_at:91:311; Interrogation_Position=294; Antisense; CCACAGCTGCCTGCGAGAGAGAATC
>probe:Drosophila_2:1641721_a_at:706:425; Interrogation_Position=308; Antisense; GAGAGAGAATCGTCCGCGCTTTCCT
>probe:Drosophila_2:1641721_a_at:712:429; Interrogation_Position=376; Antisense; GAGGCTTTGGTCAAGCCCGTCAAGA
>probe:Drosophila_2:1641721_a_at:66:561; Interrogation_Position=460; Antisense; GGAAAGCCAGGTGCCAAAGTCGCCG
>probe:Drosophila_2:1641721_a_at:337:81; Interrogation_Position=503; Antisense; AGGGCGCTCCTAAAGGAGTCGTCAA
>probe:Drosophila_2:1641721_a_at:655:227; Interrogation_Position=51; Antisense; AATGGTCCAACGCTTGACTCTGAGA
>probe:Drosophila_2:1641721_a_at:622:499; Interrogation_Position=520; Antisense; GTCGTCAAGTCCAAGAAGTAACCAT
>probe:Drosophila_2:1641721_a_at:431:403; Interrogation_Position=66; Antisense; GACTCTGAGACGACGTCTGTCGTAC

Paste this into a BLAST search page for me
GAGGCCGTCTGGTGTACCAGTACGTGAAGAAGAACCCCACTGTGCCACGCTGTGCCACGCTGTGGTCAGTGCAAGGAGCGTCCCAGGATGTCCAAGCGTTTCCAAGCGTTTGAAGACCGTCTCCATACGGAGGTGTCCTGTGCCACAGCTCCACAGCTGCCTGCGAGAGAGAATCGAGAGAGAATCGTCCGCGCTTTCCTGAGGCTTTGGTCAAGCCCGTCAAGAGGAAAGCCAGGTGCCAAAGTCGCCGAGGGCGCTCCTAAAGGAGTCGTCAAAATGGTCCAACGCTTGACTCTGAGAGTCGTCAAGTCCAAGAAGTAACCATGACTCTGAGACGACGTCTGTCGTAC

Full Affymetrix probeset data:

Annotations for 1641721_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime