FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641722_at:

>probe:Drosophila_2:1641722_at:668:587; Interrogation_Position=334; Antisense; TGGAGCGGCCATTCCCGACGAGAAG
>probe:Drosophila_2:1641722_at:363:715; Interrogation_Position=368; Antisense; TTCTCCAACCACCTAATTGAGCTAT
>probe:Drosophila_2:1641722_at:562:665; Interrogation_Position=392; Antisense; TACAAAACCTCCATTTGCTGGCAGC
>probe:Drosophila_2:1641722_at:340:197; Interrogation_Position=422; Antisense; AACGGCAGCGTGGAACTCCTTCAGC
>probe:Drosophila_2:1641722_at:662:359; Interrogation_Position=477; Antisense; GCAAGCTGGGTGTGATAGCCAACTT
>probe:Drosophila_2:1641722_at:461:333; Interrogation_Position=538; Antisense; GCTGGATCAGTACCTGGACTTTGCA
>probe:Drosophila_2:1641722_at:683:553; Interrogation_Position=553; Antisense; GGACTTTGCAATTAACTCGTACGAG
>probe:Drosophila_2:1641722_at:311:499; Interrogation_Position=628; Antisense; GTCGGGTCTGAAGAACCTCAAGCCG
>probe:Drosophila_2:1641722_at:595:201; Interrogation_Position=647; Antisense; AAGCCGGAGGAGTGCCTTCACATTG
>probe:Drosophila_2:1641722_at:536:441; Interrogation_Position=674; Antisense; GATGGTCCCACCACTGATTATCTGG
>probe:Drosophila_2:1641722_at:248:213; Interrogation_Position=740; Antisense; AAGAGCTACGCATATCTGGTCAAGA
>probe:Drosophila_2:1641722_at:95:43; Interrogation_Position=779; Antisense; ATCGATCGAGATCATGTCTTCCCCA
>probe:Drosophila_2:1641722_at:616:183; Interrogation_Position=822; Antisense; AAAAGATCTCCGACGGCGCAGTTGT
>probe:Drosophila_2:1641722_at:535:499; Interrogation_Position=845; Antisense; GTCTGGTGATTGATTGTGCACACAT

Paste this into a BLAST search page for me
TGGAGCGGCCATTCCCGACGAGAAGTTCTCCAACCACCTAATTGAGCTATTACAAAACCTCCATTTGCTGGCAGCAACGGCAGCGTGGAACTCCTTCAGCGCAAGCTGGGTGTGATAGCCAACTTGCTGGATCAGTACCTGGACTTTGCAGGACTTTGCAATTAACTCGTACGAGGTCGGGTCTGAAGAACCTCAAGCCGAAGCCGGAGGAGTGCCTTCACATTGGATGGTCCCACCACTGATTATCTGGAAGAGCTACGCATATCTGGTCAAGAATCGATCGAGATCATGTCTTCCCCAAAAAGATCTCCGACGGCGCAGTTGTGTCTGGTGATTGATTGTGCACACAT

Full Affymetrix probeset data:

Annotations for 1641722_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720