FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641725_at:

>probe:Drosophila_2:1641725_at:568:33; Interrogation_Position=1089; Antisense; ATCAATGCCTCATTTCTATCTGGGC
>probe:Drosophila_2:1641725_at:340:447; Interrogation_Position=1114; Antisense; GATCCAAAGCTGGTTGCCGACGTTG
>probe:Drosophila_2:1641725_at:655:315; Interrogation_Position=1129; Antisense; GCCGACGTTGATGGTCTCAATCCGA
>probe:Drosophila_2:1641725_at:254:61; Interrogation_Position=1192; Antisense; ATGTCTGGAACACCTTTTCAGGCTG
>probe:Drosophila_2:1641725_at:120:649; Interrogation_Position=1209; Antisense; TCAGGCTGCCAAGCGTTTGCAGTTT
>probe:Drosophila_2:1641725_at:407:239; Interrogation_Position=1355; Antisense; AATACACACTATTTCTGGGCCTAAA
>probe:Drosophila_2:1641725_at:262:181; Interrogation_Position=1377; Antisense; AAAAATCAACTCAGTCCTGCGCTGG
>probe:Drosophila_2:1641725_at:56:15; Interrogation_Position=1408; Antisense; ATTACTTTCTCCCTGGTGGGCCTGA
>probe:Drosophila_2:1641725_at:647:441; Interrogation_Position=1431; Antisense; GATGTTTTCCGCCTATCTTTTCTAC
>probe:Drosophila_2:1641725_at:363:639; Interrogation_Position=1446; Antisense; TCTTTTCTACCACAAATCCGACAGT
>probe:Drosophila_2:1641725_at:617:223; Interrogation_Position=1504; Antisense; AAGGTAGACGACGTGGCCAGCACAA
>probe:Drosophila_2:1641725_at:260:169; Interrogation_Position=1527; Antisense; AAAGGAGCCCTTGCCTTCAGCAAAT
>probe:Drosophila_2:1641725_at:446:173; Interrogation_Position=1554; Antisense; AAAGCAATCTTCTACTGTGCACCCT
>probe:Drosophila_2:1641725_at:97:249; Interrogation_Position=1590; Antisense; CAATACTCTGATTCCCGGCACGAAT

Paste this into a BLAST search page for me
ATCAATGCCTCATTTCTATCTGGGCGATCCAAAGCTGGTTGCCGACGTTGGCCGACGTTGATGGTCTCAATCCGAATGTCTGGAACACCTTTTCAGGCTGTCAGGCTGCCAAGCGTTTGCAGTTTAATACACACTATTTCTGGGCCTAAAAAAAATCAACTCAGTCCTGCGCTGGATTACTTTCTCCCTGGTGGGCCTGAGATGTTTTCCGCCTATCTTTTCTACTCTTTTCTACCACAAATCCGACAGTAAGGTAGACGACGTGGCCAGCACAAAAAGGAGCCCTTGCCTTCAGCAAATAAAGCAATCTTCTACTGTGCACCCTCAATACTCTGATTCCCGGCACGAAT

Full Affymetrix probeset data:

Annotations for 1641725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720