Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641727_at:

>probe:Drosophila_2:1641727_at:100:247; Interrogation_Position=357; Antisense; AATTCGCTGACATTGATGGACCATA
>probe:Drosophila_2:1641727_at:13:415; Interrogation_Position=398; Antisense; GACCAACATAGTGGACGCGGATGCA
>probe:Drosophila_2:1641727_at:419:331; Interrogation_Position=414; Antisense; GCGGATGCAGTTGAGTCGCCACCAG
>probe:Drosophila_2:1641727_at:498:365; Interrogation_Position=443; Antisense; GAATCCGATTTCTGGAGATACCGTG
>probe:Drosophila_2:1641727_at:29:429; Interrogation_Position=457; Antisense; GAGATACCGTGGAGATCCTGCCTAC
>probe:Drosophila_2:1641727_at:128:671; Interrogation_Position=479; Antisense; TACTGGCGCACCTAGTTCCGTCGTA
>probe:Drosophila_2:1641727_at:119:437; Interrogation_Position=558; Antisense; GAGGAGGATCCCACCGTGCAAAAGA
>probe:Drosophila_2:1641727_at:640:523; Interrogation_Position=660; Antisense; GGTCGAACCGAGTACAAGGGCATCA
>probe:Drosophila_2:1641727_at:693:651; Interrogation_Position=682; Antisense; TCAAGGTGACGTTGCCGGAATCGGC
>probe:Drosophila_2:1641727_at:53:289; Interrogation_Position=697; Antisense; CGGAATCGGCCAACCAGGATGTCGG
>probe:Drosophila_2:1641727_at:294:77; Interrogation_Position=712; Antisense; AGGATGTCGGCACTTATCGCTTCCG
>probe:Drosophila_2:1641727_at:193:135; Interrogation_Position=774; Antisense; ACGCGCCTGGTTCGATACGACAAGT
>probe:Drosophila_2:1641727_at:222:701; Interrogation_Position=829; Antisense; TTTTTTGGACGACTTCCGCTTGCGA
>probe:Drosophila_2:1641727_at:476:301; Interrogation_Position=844; Antisense; CCGCTTGCGACTATTCCAATTTTTT

Paste this into a BLAST search page for me
AATTCGCTGACATTGATGGACCATAGACCAACATAGTGGACGCGGATGCAGCGGATGCAGTTGAGTCGCCACCAGGAATCCGATTTCTGGAGATACCGTGGAGATACCGTGGAGATCCTGCCTACTACTGGCGCACCTAGTTCCGTCGTAGAGGAGGATCCCACCGTGCAAAAGAGGTCGAACCGAGTACAAGGGCATCATCAAGGTGACGTTGCCGGAATCGGCCGGAATCGGCCAACCAGGATGTCGGAGGATGTCGGCACTTATCGCTTCCGACGCGCCTGGTTCGATACGACAAGTTTTTTTGGACGACTTCCGCTTGCGACCGCTTGCGACTATTCCAATTTTTT

Full Affymetrix probeset data:

Annotations for 1641727_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime