FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641729_at:

>probe:Drosophila_2:1641729_at:291:481; Interrogation_Position=103; Antisense; GTATTGTCTGCTCTGCTCGCTGTAG
>probe:Drosophila_2:1641729_at:654:113; Interrogation_Position=183; Antisense; AGCAGCGACGACCATCGTCCAGGAG
>probe:Drosophila_2:1641729_at:62:555; Interrogation_Position=226; Antisense; GGAGCCGTGGTCAAGAGCGTACCCA
>probe:Drosophila_2:1641729_at:680:615; Interrogation_Position=281; Antisense; TGCACAGTCACGCTCATGTTGTCGA
>probe:Drosophila_2:1641729_at:149:59; Interrogation_Position=296; Antisense; ATGTTGTCGAGGATGTCGTTGCTCC
>probe:Drosophila_2:1641729_at:416:501; Interrogation_Position=310; Antisense; GTCGTTGCTCCCGTGGTGAAGTCCA
>probe:Drosophila_2:1641729_at:423:467; Interrogation_Position=397; Antisense; GTTGTCCACACCAGTTACGCTGCTC
>probe:Drosophila_2:1641729_at:193:279; Interrogation_Position=510; Antisense; CTACACCGCCACTGGTGTGTGGTAA
>probe:Drosophila_2:1641729_at:330:593; Interrogation_Position=527; Antisense; TGTGGTAAATCCATGGCCAGGCCCA
>probe:Drosophila_2:1641729_at:412:669; Interrogation_Position=562; Antisense; TACTCCTCTCACTGTTGACAGGTGA
>probe:Drosophila_2:1641729_at:608:153; Interrogation_Position=579; Antisense; ACAGGTGACCAGGATGCATGTGCAT
>probe:Drosophila_2:1641729_at:409:89; Interrogation_Position=59; Antisense; AGTCAATACAGACCTAACCCATTTC
>probe:Drosophila_2:1641729_at:651:51; Interrogation_Position=592; Antisense; ATGCATGTGCATCGCTGGACGGTTT
>probe:Drosophila_2:1641729_at:324:297; Interrogation_Position=604; Antisense; CGCTGGACGGTTTTGTGATACGAAT

Paste this into a BLAST search page for me
GTATTGTCTGCTCTGCTCGCTGTAGAGCAGCGACGACCATCGTCCAGGAGGGAGCCGTGGTCAAGAGCGTACCCATGCACAGTCACGCTCATGTTGTCGAATGTTGTCGAGGATGTCGTTGCTCCGTCGTTGCTCCCGTGGTGAAGTCCAGTTGTCCACACCAGTTACGCTGCTCCTACACCGCCACTGGTGTGTGGTAATGTGGTAAATCCATGGCCAGGCCCATACTCCTCTCACTGTTGACAGGTGAACAGGTGACCAGGATGCATGTGCATAGTCAATACAGACCTAACCCATTTCATGCATGTGCATCGCTGGACGGTTTCGCTGGACGGTTTTGTGATACGAAT

Full Affymetrix probeset data:

Annotations for 1641729_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720