FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641731_at:

>probe:Drosophila_2:1641731_at:295:381; Interrogation_Position=322; Antisense; GAACGACTGGGCTATACCACTGGCT
>probe:Drosophila_2:1641731_at:88:141; Interrogation_Position=340; Antisense; ACTGGCTACGGATCCCTAAATGGTT
>probe:Drosophila_2:1641731_at:451:229; Interrogation_Position=358; Antisense; AATGGTTATCCTGGCGGTACTGGAC
>probe:Drosophila_2:1641731_at:236:729; Interrogation_Position=422; Antisense; TTGTCTTAGGAACTCTTGTGGGCAT
>probe:Drosophila_2:1641731_at:44:605; Interrogation_Position=461; Antisense; TGATTCCTAAGATTCTATCCGCCTT
>probe:Drosophila_2:1641731_at:152:611; Interrogation_Position=525; Antisense; TGACCTAACACCACTGAGCAGCATG
>probe:Drosophila_2:1641731_at:407:95; Interrogation_Position=557; Antisense; AGATTGACGATGTTCTGGGCCAGAA
>probe:Drosophila_2:1641731_at:657:269; Interrogation_Position=603; Antisense; CATGCAACGTGCTGTGTGCGGTTAT
>probe:Drosophila_2:1641731_at:117:291; Interrogation_Position=621; Antisense; CGGTTATGTTCGCTCTACGGAGTAT
>probe:Drosophila_2:1641731_at:426:375; Interrogation_Position=651; Antisense; GAAGATCGGTTCCTCAGACCAGATG
>probe:Drosophila_2:1641731_at:58:183; Interrogation_Position=701; Antisense; AAAATGCCCTGGTGGATTACCTCCT
>probe:Drosophila_2:1641731_at:475:13; Interrogation_Position=716; Antisense; ATTACCTCCTCGATGGAACGGCTAT
>probe:Drosophila_2:1641731_at:223:415; Interrogation_Position=767; Antisense; GAGCCAATGATCGAGCCTGTGAAGA
>probe:Drosophila_2:1641731_at:318:101; Interrogation_Position=789; Antisense; AGAGGTGTACTCCAATTGTCCGCTG

Paste this into a BLAST search page for me
GAACGACTGGGCTATACCACTGGCTACTGGCTACGGATCCCTAAATGGTTAATGGTTATCCTGGCGGTACTGGACTTGTCTTAGGAACTCTTGTGGGCATTGATTCCTAAGATTCTATCCGCCTTTGACCTAACACCACTGAGCAGCATGAGATTGACGATGTTCTGGGCCAGAACATGCAACGTGCTGTGTGCGGTTATCGGTTATGTTCGCTCTACGGAGTATGAAGATCGGTTCCTCAGACCAGATGAAAATGCCCTGGTGGATTACCTCCTATTACCTCCTCGATGGAACGGCTATGAGCCAATGATCGAGCCTGTGAAGAAGAGGTGTACTCCAATTGTCCGCTG

Full Affymetrix probeset data:

Annotations for 1641731_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720