FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641732_at:

>probe:Drosophila_2:1641732_at:687:469; Interrogation_Position=124; Antisense; GTTCCAGTTCTGGTACTAGGTCTCC
>probe:Drosophila_2:1641732_at:360:145; Interrogation_Position=138; Antisense; ACTAGGTCTCCTTGTCTGGGTCCGG
>probe:Drosophila_2:1641732_at:540:639; Interrogation_Position=152; Antisense; TCTGGGTCCGGGTTCTTGCCGCTTT
>probe:Drosophila_2:1641732_at:60:343; Interrogation_Position=172; Antisense; GCTTTTGGTCTCTGTTTGTCGCAAA
>probe:Drosophila_2:1641732_at:309:723; Interrogation_Position=187; Antisense; TTGTCGCAAAATCCTCCCTTGGTGA
>probe:Drosophila_2:1641732_at:444:105; Interrogation_Position=31; Antisense; AGAAACGAGTTTGTCGGGAGATTGC
>probe:Drosophila_2:1641732_at:648:541; Interrogation_Position=317; Antisense; GGTTGCATAATGGTATTCATCTGGA
>probe:Drosophila_2:1641732_at:324:83; Interrogation_Position=446; Antisense; AGGGCGAGACGGTCAGCAATCAGTT
>probe:Drosophila_2:1641732_at:543:361; Interrogation_Position=461; Antisense; GCAATCAGTTGCCACTGCGGGTGAA
>probe:Drosophila_2:1641732_at:428:329; Interrogation_Position=477; Antisense; GCGGGTGAAATACGCCAGTCCTGAT
>probe:Drosophila_2:1641732_at:175:493; Interrogation_Position=548; Antisense; GTAATGAGTCGGGTGCCCTGGCACT
>probe:Drosophila_2:1641732_at:398:627; Interrogation_Position=578; Antisense; TGCCACTGCCACTGCTACTGGCTTA
>probe:Drosophila_2:1641732_at:113:679; Interrogation_Position=66; Antisense; TATCCGTGGTGGAACGGTCCAGGTC
>probe:Drosophila_2:1641732_at:267:581; Interrogation_Position=72; Antisense; TGGTGGAACGGTCCAGGTCCTCTTC

Paste this into a BLAST search page for me
GTTCCAGTTCTGGTACTAGGTCTCCACTAGGTCTCCTTGTCTGGGTCCGGTCTGGGTCCGGGTTCTTGCCGCTTTGCTTTTGGTCTCTGTTTGTCGCAAATTGTCGCAAAATCCTCCCTTGGTGAAGAAACGAGTTTGTCGGGAGATTGCGGTTGCATAATGGTATTCATCTGGAAGGGCGAGACGGTCAGCAATCAGTTGCAATCAGTTGCCACTGCGGGTGAAGCGGGTGAAATACGCCAGTCCTGATGTAATGAGTCGGGTGCCCTGGCACTTGCCACTGCCACTGCTACTGGCTTATATCCGTGGTGGAACGGTCCAGGTCTGGTGGAACGGTCCAGGTCCTCTTC

Full Affymetrix probeset data:

Annotations for 1641732_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720