Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641733_a_at:

>probe:Drosophila_2:1641733_a_at:659:637; Interrogation_Position=388; Antisense; TCGATGTCAAGAACTCAGCCGAGTT
>probe:Drosophila_2:1641733_a_at:506:53; Interrogation_Position=423; Antisense; ATGAAAGCGGCAGCTCCCCAGGCGG
>probe:Drosophila_2:1641733_a_at:618:631; Interrogation_Position=437; Antisense; TCCCCAGGCGGGTGCGGAAACAAAT
>probe:Drosophila_2:1641733_a_at:261:591; Interrogation_Position=461; Antisense; TGGTCAAGCGAATAGCGCCGCCCAT
>probe:Drosophila_2:1641733_a_at:237:301; Interrogation_Position=478; Antisense; CCGCCCATGACGAGGACCTTATCAT
>probe:Drosophila_2:1641733_a_at:621:127; Interrogation_Position=493; Antisense; ACCTTATCATGGAAGCCACCGGCGG
>probe:Drosophila_2:1641733_a_at:580:121; Interrogation_Position=551; Antisense; AGCCTTGATAAAGAACCCCGTGCGC
>probe:Drosophila_2:1641733_a_at:347:447; Interrogation_Position=614; Antisense; GATGCTGATCATCACGGACAACATT
>probe:Drosophila_2:1641733_a_at:678:397; Interrogation_Position=630; Antisense; GACAACATTGGTATTCGATGCCCAG
>probe:Drosophila_2:1641733_a_at:379:225; Interrogation_Position=702; Antisense; AAGGACTCCAACCTACAGCAGAAGT
>probe:Drosophila_2:1641733_a_at:250:213; Interrogation_Position=730; Antisense; AAGAGCGCATGTCTGACGCGATCGA
>probe:Drosophila_2:1641733_a_at:95:655; Interrogation_Position=798; Antisense; TAATTATGCGCAACTTCCTTCTTGT
>probe:Drosophila_2:1641733_a_at:21:273; Interrogation_Position=818; Antisense; CTTGTCGACTAATAACGCAGCGTAA
>probe:Drosophila_2:1641733_a_at:613:351; Interrogation_Position=834; Antisense; GCAGCGTAAGATATCACGTTCTTGT

Paste this into a BLAST search page for me
TCGATGTCAAGAACTCAGCCGAGTTATGAAAGCGGCAGCTCCCCAGGCGGTCCCCAGGCGGGTGCGGAAACAAATTGGTCAAGCGAATAGCGCCGCCCATCCGCCCATGACGAGGACCTTATCATACCTTATCATGGAAGCCACCGGCGGAGCCTTGATAAAGAACCCCGTGCGCGATGCTGATCATCACGGACAACATTGACAACATTGGTATTCGATGCCCAGAAGGACTCCAACCTACAGCAGAAGTAAGAGCGCATGTCTGACGCGATCGATAATTATGCGCAACTTCCTTCTTGTCTTGTCGACTAATAACGCAGCGTAAGCAGCGTAAGATATCACGTTCTTGT

Full Affymetrix probeset data:

Annotations for 1641733_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime