FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641734_at:

>probe:Drosophila_2:1641734_at:630:331; Interrogation_Position=1037; Antisense; GCTGTGGTTCATGGCGTGGACACCA
>probe:Drosophila_2:1641734_at:92:521; Interrogation_Position=1052; Antisense; GTGGACACCATACCTGGTCATCAAC
>probe:Drosophila_2:1641734_at:34:537; Interrogation_Position=1067; Antisense; GGTCATCAACTGCATGGGACTGTTC
>probe:Drosophila_2:1641734_at:647:405; Interrogation_Position=1084; Antisense; GACTGTTCAAGTTCGAGGGCCTTAC
>probe:Drosophila_2:1641734_at:565:313; Interrogation_Position=1102; Antisense; GCCTTACACCACTGAATACCATTTG
>probe:Drosophila_2:1641734_at:535:523; Interrogation_Position=1127; Antisense; GGGAGCTTGCTTCGCCAAATCGGCC
>probe:Drosophila_2:1641734_at:97:321; Interrogation_Position=1149; Antisense; GCCGCCTGCTACAATCCAATTGTAT
>probe:Drosophila_2:1641734_at:593:47; Interrogation_Position=1162; Antisense; ATCCAATTGTATACGGCATCAGCCA
>probe:Drosophila_2:1641734_at:423:35; Interrogation_Position=1179; Antisense; ATCAGCCATCCGAAATATCGCCTGG
>probe:Drosophila_2:1641734_at:315:685; Interrogation_Position=1194; Antisense; TATCGCCTGGCCCTCAAGGAGAAGT
>probe:Drosophila_2:1641734_at:703:551; Interrogation_Position=1211; Antisense; GGAGAAGTGTCCTTGCTGCGTCTTT
>probe:Drosophila_2:1641734_at:18:499; Interrogation_Position=1230; Antisense; GTCTTTGGCAAGGTCGACGATGGCA
>probe:Drosophila_2:1641734_at:708:165; Interrogation_Position=1254; Antisense; AAATCGAGCGATGCCCAATCGCAGG
>probe:Drosophila_2:1641734_at:420:569; Interrogation_Position=1304; Antisense; GGCATAAATTCTTTGGCGCAACAAC

Paste this into a BLAST search page for me
GCTGTGGTTCATGGCGTGGACACCAGTGGACACCATACCTGGTCATCAACGGTCATCAACTGCATGGGACTGTTCGACTGTTCAAGTTCGAGGGCCTTACGCCTTACACCACTGAATACCATTTGGGGAGCTTGCTTCGCCAAATCGGCCGCCGCCTGCTACAATCCAATTGTATATCCAATTGTATACGGCATCAGCCAATCAGCCATCCGAAATATCGCCTGGTATCGCCTGGCCCTCAAGGAGAAGTGGAGAAGTGTCCTTGCTGCGTCTTTGTCTTTGGCAAGGTCGACGATGGCAAAATCGAGCGATGCCCAATCGCAGGGGCATAAATTCTTTGGCGCAACAAC

Full Affymetrix probeset data:

Annotations for 1641734_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720