Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641735_at:

>probe:Drosophila_2:1641735_at:234:369; Interrogation_Position=2683; Antisense; GAATGTTTCTCCAGTGGTCTGCCAT
>probe:Drosophila_2:1641735_at:152:419; Interrogation_Position=2728; Antisense; GAGCTGCTGCCATTAGTGCATCTAG
>probe:Drosophila_2:1641735_at:21:39; Interrogation_Position=2747; Antisense; ATCTAGTGTGGCAACCTCTGATCGA
>probe:Drosophila_2:1641735_at:669:337; Interrogation_Position=2829; Antisense; GCTAGGCGTTCATGCCAAGGACTTT
>probe:Drosophila_2:1641735_at:200:351; Interrogation_Position=2864; Antisense; GCAGCCTTAGTGATGTGATACCCCA
>probe:Drosophila_2:1641735_at:465:601; Interrogation_Position=2879; Antisense; TGATACCCCAGTTAAAGCAGTTCCT
>probe:Drosophila_2:1641735_at:235:115; Interrogation_Position=2894; Antisense; AGCAGTTCCTGAAGACAGCATCCCT
>probe:Drosophila_2:1641735_at:588:635; Interrogation_Position=2938; Antisense; TCGCAAGCGCAGACTCAGGAGTACA
>probe:Drosophila_2:1641735_at:531:333; Interrogation_Position=2979; Antisense; GCTGAAGAGCCTCGCGGACTTTATA
>probe:Drosophila_2:1641735_at:224:557; Interrogation_Position=2994; Antisense; GGACTTTATACTCGGTCTTCAGATA
>probe:Drosophila_2:1641735_at:683:645; Interrogation_Position=3110; Antisense; TCTTCCTCCAGCTTATTTCTTACAA
>probe:Drosophila_2:1641735_at:697:663; Interrogation_Position=3130; Antisense; TACAATGGACCCTTCGTATACGTTA
>probe:Drosophila_2:1641735_at:16:289; Interrogation_Position=3166; Antisense; CGGGCCCATCTTCAGGATTATCAGG
>probe:Drosophila_2:1641735_at:651:265; Interrogation_Position=3202; Antisense; CAGATCTTCGAGGTCATGGGCTTTA

Paste this into a BLAST search page for me
GAATGTTTCTCCAGTGGTCTGCCATGAGCTGCTGCCATTAGTGCATCTAGATCTAGTGTGGCAACCTCTGATCGAGCTAGGCGTTCATGCCAAGGACTTTGCAGCCTTAGTGATGTGATACCCCATGATACCCCAGTTAAAGCAGTTCCTAGCAGTTCCTGAAGACAGCATCCCTTCGCAAGCGCAGACTCAGGAGTACAGCTGAAGAGCCTCGCGGACTTTATAGGACTTTATACTCGGTCTTCAGATATCTTCCTCCAGCTTATTTCTTACAATACAATGGACCCTTCGTATACGTTACGGGCCCATCTTCAGGATTATCAGGCAGATCTTCGAGGTCATGGGCTTTA

Full Affymetrix probeset data:

Annotations for 1641735_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime