FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641739_at:

>probe:Drosophila_2:1641739_at:343:375; Interrogation_Position=182; Antisense; GAAGATCCCGCCGTTAATTTCAAGT
>probe:Drosophila_2:1641739_at:428:413; Interrogation_Position=215; Antisense; GACCAGATCAGTTAGCACGTTTCGA
>probe:Drosophila_2:1641739_at:98:541; Interrogation_Position=243; Antisense; GGTTAATATTAGCACCCAGCGCATT
>probe:Drosophila_2:1641739_at:207:447; Interrogation_Position=274; Antisense; GATCCAGAAATAGCCGGGTTCCGAT
>probe:Drosophila_2:1641739_at:692:195; Interrogation_Position=325; Antisense; AACGGCGTGCGAAGTGTCTTGACCT
>probe:Drosophila_2:1641739_at:72:667; Interrogation_Position=349; Antisense; TACAGCAATGAGTCCATCCACTTGG
>probe:Drosophila_2:1641739_at:280:523; Interrogation_Position=377; Antisense; GGGCTTCACCAGTGCGTTAATTAGC
>probe:Drosophila_2:1641739_at:632:373; Interrogation_Position=418; Antisense; GAAGTACCACAGTGGCACTCCGAGT
>probe:Drosophila_2:1641739_at:38:147; Interrogation_Position=450; Antisense; ACTCGTTCGCCGGTCAAATGGGCAA
>probe:Drosophila_2:1641739_at:685:233; Interrogation_Position=478; Antisense; AATGCCACTGTCTAACTATTTTGAT
>probe:Drosophila_2:1641739_at:654:119; Interrogation_Position=519; Antisense; AGCTGATCTTCTGCGGCACAGAGTT
>probe:Drosophila_2:1641739_at:456:195; Interrogation_Position=562; Antisense; AACTGACTCATCATCCCGGAGGGAT
>probe:Drosophila_2:1641739_at:389:39; Interrogation_Position=594; Antisense; ATCTGGGTGATCTCGTCATGCATAT
>probe:Drosophila_2:1641739_at:76:455; Interrogation_Position=625; Antisense; GATAAACAGCGGCATTCCAATCCCA

Paste this into a BLAST search page for me
GAAGATCCCGCCGTTAATTTCAAGTGACCAGATCAGTTAGCACGTTTCGAGGTTAATATTAGCACCCAGCGCATTGATCCAGAAATAGCCGGGTTCCGATAACGGCGTGCGAAGTGTCTTGACCTTACAGCAATGAGTCCATCCACTTGGGGGCTTCACCAGTGCGTTAATTAGCGAAGTACCACAGTGGCACTCCGAGTACTCGTTCGCCGGTCAAATGGGCAAAATGCCACTGTCTAACTATTTTGATAGCTGATCTTCTGCGGCACAGAGTTAACTGACTCATCATCCCGGAGGGATATCTGGGTGATCTCGTCATGCATATGATAAACAGCGGCATTCCAATCCCA

Full Affymetrix probeset data:

Annotations for 1641739_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720