Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641741_a_at:

>probe:Drosophila_2:1641741_a_at:648:563; Interrogation_Position=112; Antisense; GGAATTGGCCAAATACAGTGAGGAT
>probe:Drosophila_2:1641741_a_at:338:683; Interrogation_Position=179; Antisense; TATGCCGAAGCGCTGTCAATGTCCG
>probe:Drosophila_2:1641741_a_at:220:441; Interrogation_Position=225; Antisense; GATGGACTCGAAGGTCCTGCTGCAC
>probe:Drosophila_2:1641741_a_at:656:621; Interrogation_Position=242; Antisense; TGCTGCACTCGCCAAGTCCTGAGTA
>probe:Drosophila_2:1641741_a_at:122:627; Interrogation_Position=25; Antisense; TCCAGCTATTCGCTTGGGTTAGTCG
>probe:Drosophila_2:1641741_a_at:607:251; Interrogation_Position=254; Antisense; CAAGTCCTGAGTACGGGCGCCATTT
>probe:Drosophila_2:1641741_a_at:668:715; Interrogation_Position=288; Antisense; TTCTGCTCATCATCGGCGCCATTTA
>probe:Drosophila_2:1641741_a_at:399:639; Interrogation_Position=300; Antisense; TCGGCGCCATTTACATGCACTTAAG
>probe:Drosophila_2:1641741_a_at:587:107; Interrogation_Position=327; Antisense; AGAAGCATCATCTGGGCCGACTGCA
>probe:Drosophila_2:1641741_a_at:335:523; Interrogation_Position=340; Antisense; GGGCCGACTGCACATCAATCTCAAG
>probe:Drosophila_2:1641741_a_at:123:589; Interrogation_Position=387; Antisense; TGGAGGAGGACTTTCCCATGGTCAC
>probe:Drosophila_2:1641741_a_at:115:529; Interrogation_Position=40; Antisense; GGGTTAGTCGGTTTGCGATAGCAAA
>probe:Drosophila_2:1641741_a_at:140:223; Interrogation_Position=63; Antisense; AAGGGAGAAGCCAGCTCGCCATGGA
>probe:Drosophila_2:1641741_a_at:542:117; Interrogation_Position=75; Antisense; AGCTCGCCATGGAGCCCACATGCAG

Paste this into a BLAST search page for me
GGAATTGGCCAAATACAGTGAGGATTATGCCGAAGCGCTGTCAATGTCCGGATGGACTCGAAGGTCCTGCTGCACTGCTGCACTCGCCAAGTCCTGAGTATCCAGCTATTCGCTTGGGTTAGTCGCAAGTCCTGAGTACGGGCGCCATTTTTCTGCTCATCATCGGCGCCATTTATCGGCGCCATTTACATGCACTTAAGAGAAGCATCATCTGGGCCGACTGCAGGGCCGACTGCACATCAATCTCAAGTGGAGGAGGACTTTCCCATGGTCACGGGTTAGTCGGTTTGCGATAGCAAAAAGGGAGAAGCCAGCTCGCCATGGAAGCTCGCCATGGAGCCCACATGCAG

Full Affymetrix probeset data:

Annotations for 1641741_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime