Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641746_at:

>probe:Drosophila_2:1641746_at:234:89; Interrogation_Position=233; Antisense; AGTCAGCTGCACTACCATGGTGTAA
>probe:Drosophila_2:1641746_at:82:75; Interrogation_Position=286; Antisense; AGGACATTCCTTTGGAGGCGGCTCC
>probe:Drosophila_2:1641746_at:183:161; Interrogation_Position=328; Antisense; ACAACCACAAATTCCCATCGTTAGG
>probe:Drosophila_2:1641746_at:32:417; Interrogation_Position=352; Antisense; GAGCGATTATAACAGCGACGCCAAT
>probe:Drosophila_2:1641746_at:641:411; Interrogation_Position=368; Antisense; GACGCCAATGGCAACTACAACTTCG
>probe:Drosophila_2:1641746_at:292:663; Interrogation_Position=383; Antisense; TACAACTTCGGTTTTGACACTGGTA
>probe:Drosophila_2:1641746_at:308:657; Interrogation_Position=406; Antisense; TAATGGTATTCACCGCGATGAGACC
>probe:Drosophila_2:1641746_at:153:595; Interrogation_Position=465; Antisense; TGGGCGTCCAGGGATCCTACTCATA
>probe:Drosophila_2:1641746_at:419:489; Interrogation_Position=511; Antisense; GTACACGGTGAACTACACGGCCGAT
>probe:Drosophila_2:1641746_at:58:197; Interrogation_Position=539; Antisense; AACGGATTCCATGCCGAAGGTGCCC
>probe:Drosophila_2:1641746_at:373:121; Interrogation_Position=598; Antisense; AGCTGGACGCAGCTCTTATGGCGCT
>probe:Drosophila_2:1641746_at:543:131; Interrogation_Position=636; Antisense; ACCGTGGATCGGCTTCATCGCATGT
>probe:Drosophila_2:1641746_at:473:313; Interrogation_Position=705; Antisense; GCCAGCGCAGGCACTACTAAGTGAT
>probe:Drosophila_2:1641746_at:692:153; Interrogation_Position=746; Antisense; ACAGGAGCGCCTACGAGCCAGTAAT

Paste this into a BLAST search page for me
AGTCAGCTGCACTACCATGGTGTAAAGGACATTCCTTTGGAGGCGGCTCCACAACCACAAATTCCCATCGTTAGGGAGCGATTATAACAGCGACGCCAATGACGCCAATGGCAACTACAACTTCGTACAACTTCGGTTTTGACACTGGTATAATGGTATTCACCGCGATGAGACCTGGGCGTCCAGGGATCCTACTCATAGTACACGGTGAACTACACGGCCGATAACGGATTCCATGCCGAAGGTGCCCAGCTGGACGCAGCTCTTATGGCGCTACCGTGGATCGGCTTCATCGCATGTGCCAGCGCAGGCACTACTAAGTGATACAGGAGCGCCTACGAGCCAGTAAT

Full Affymetrix probeset data:

Annotations for 1641746_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime